CLON Wiscseq_DsLox343B03.0  T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG CHRO chr1 EVAL 0 COOR C/73464-73464 NOTE KG799953 Wisc 10K 1:73442 ACAGCTGTCGCTGCCCAGGTTGTTTGTGATGATAAAACTCAATTGCGATCTATCACAGAAATTTAATGTTGTTTGGGGGTTTGCTTAGACAACTTAATAA HITS AT1G01160.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01160.1 CDS ID=AT1G01160.1; Parent=AT1G01160; Name=AT1G01160.1; Note=GRF1-interacting factor 2; curator_summary=Arabidopsis thaliana GRF1-interacting factor 2 (GIF2) mRNA; conf_class=2; symbol=GIF2; full_name=GRF1-interacting factor 2; computational_description=GRF1-interacting factor 2 (GIF2)%3B CONTAINS InterPro DOMAIN/s: SSXT (InterPro:IPR007726)%3B BEST Arabidopsis thaliana protein match is: GRF1-interacting factor 3 (TAIR:AT4G00850.1)%3B Has 425 Blast hits to 425 proteins in 91 species: Archae - 0%3B Bacteria - 4%3B Metazoa - 291%3B Fungi - 20%3B Plants - 89%3B Viruses - 0%3B Other Eukaryotes - 21 (source: NCBI BLink).; conf_rating=****; Dbxref=PMID:12974814, PMID:15326298, PMID:15703057, PMID:17182867, PMID:19648231, PMID:22589469, PMID:22669825, PMID:24355747, locus:2035232; locus_type=protein_coding LOCN Intron COOR W/72583-72669,73087-73163,73287-73395,73488-73740,73822-73883 HITS AT1G01160.2[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01160.2 CDS ID=AT1G01160.2; Parent=AT1G01160; Name=AT1G01160.2; Note=GRF1-interacting factor 2; curator_summary=Arabidopsis thaliana GRF1-interacting factor 2 (GIF2) mRNA; conf_class=6; symbol=GIF2; full_name=GRF1-interacting factor 2; computational_description=GRF1-interacting factor 2 (GIF2)%3B CONTAINS InterPro DOMAIN/s: SSXT (InterPro:IPR007726)%3B BEST Arabidopsis thaliana protein match is: GRF1-interacting factor 3 (TAIR:AT4G00850.1)%3B Has 425 Blast hits to 425 proteins in 91 species: Archae - 0%3B Bacteria - 4%3B Metazoa - 291%3B Fungi - 20%3B Plants - 89%3B Viruses - 0%3B Other Eukaryotes - 21 (source: NCBI BLink).; conf_rating=**; Dbxref=PMID:12974814, PMID:15326298, PMID:15703057, PMID:17182867, PMID:19648231, PMID:22589469, PMID:22669825, PMID:24355747, locus:2035232; locus_type=protein_coding LOCN Intron COOR W/72583-72669,72915-73016,73087-73163,73287-73395,73488-73740,73822-73883 HITS AT1G04007.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G04007.1 antisense_lncRNA ID=AT1G04007.1; Parent=AT1G04007; Name=AT1G04007.1; description=Natural antisense transcript overlaps with AT1G01160; Note=Natural antisense transcript overlaps with AT1G01160; locus_type=antisense_long_noncoding_rna LOCN 1000-Promotor COOR C/72646-73108 HITS AT1G04013.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G04013.1 antisense_lncRNA ID=AT1G04013.1; Parent=AT1G04013; Name=AT1G04013.1; description=Natural antisense transcript overlaps with AT1G01170; Note=Natural antisense transcript overlaps with AT1G01170; locus_type=antisense_long_noncoding_rna LOCN 1000-Promotor COOR W/74435-74683