CLON SALKseq_47981.1  T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG CHRO chr1 EVAL 0 COOR C/89276-89276 NOTE KO444167 Salk 50K 1:89279 GGTTAAGAAATCTATAGAAGCTGTTGTGACTAAAGATGATATACCCACAGCTGCTGAAACTGAAGGTATTTTCAGTCT HITS AT1G01210.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01210.1 CDS ID=AT1G01210.1; Parent=AT1G01210; Name=AT1G01210.1; Note=DNA-directed RNA polymerase%2C subunit M%2C archaeal; conf_class=1; computational_description=DNA-directed RNA polymerase%2C subunit M%2C archaeal%3B FUNCTIONS IN: in 6 functions%3B INVOLVED IN: RNA elongation%2C regulation of transcription%2C DNA-dependent%2C transcription%2C regulation of transcription%3B LOCATED IN: nucleus%3B CONTAINS InterPro DOMAIN/s: Zinc finger%2C TFIIS-type (InterPro:IPR001222)%2C DNA-directed RNA polymerase%2C M/15kDa subunit (InterPro:IPR001529)%2C DNA-directed RNA polymerase%2C subunit M%2C archaeal (InterPro:IPR006288)%2C DNA-directed RNA polymerase M%2C 15kDa subunit%2C conserved site (InterPro:IPR019761)%3B BEST Arabidopsis thaliana protein match is: DNA-directed RNA polymerase%2C subunit M%2C archaeal (TAIR:AT4G07950.1)%3B Has 1129 Blast hits to 1129 proteins in 326 species: Archae - 242%3B Bacteria - 0%3B Metazoa - 276%3B Fungi - 294%3B Plants - 112%3B Viruses - 0%3B Other Eukaryotes - 205 (source: NCBI BLink).; conf_rating=*****; Dbxref=PMID:17447913, locus:2035322; locus_type=protein_coding LOCN Intron COOR W/88977-89081,89173-89263,89405-89529 HITS AT1G01210.2[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01210.2 CDS ID=AT1G01210.2; Parent=AT1G01210; Name=AT1G01210.2; Note=DNA-directed RNA polymerase%2C subunit M%2C archaeal; Dbxref=PMID:17447913, locus:2035322; computational_description=DNA-directed RNA polymerase%2C subunit M%2C archaeal%3B FUNCTIONS IN: in 6 functions%3B INVOLVED IN: RNA elongation%2C regulation of transcription%2C DNA-dependent%2C transcription%2C regulation of transcription%3B LOCATED IN: nucleus%3B CONTAINS InterPro DOMAIN/s: Zinc finger%2C TFIIS-type (InterPro:IPR001222)%2C DNA-directed RNA polymerase%2C M/15kDa subunit (InterPro:IPR001529)%2C DNA-directed RNA polymerase%2C subunit M%2C archaeal (InterPro:IPR006288)%2C DNA-directed RNA polymerase M%2C 15kDa subunit%2C conserved site (InterPro:IPR019761)%3B BEST Arabidopsis thaliana protein match is: DNA-directed RNA polymerase%2C subunit M%2C archaeal (TAIR:AT4G07950.1)%3B Has 1129 Blast hits to 1129 proteins in 326 species: Archae - 242%3B Bacteria - 0%3B Metazoa - 276%3B Fungi - 294%3B Plants - 112%3B Viruses - 0%3B Other Eukaryotes - 205 (source: NCBI BLink).; locus_type=protein_coding LOCN Intron COOR W/88977-89081,89173-89263,89405-89529 HITS AT1G01210.3[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01210.3 CDS ID=AT1G01210.3; Parent=AT1G01210; Name=AT1G01210.3; Note=DNA-directed RNA polymerase%2C subunit M%2C archaeal; Dbxref=PMID:17447913, locus:2035322; computational_description=DNA-directed RNA polymerase%2C subunit M%2C archaeal%3B FUNCTIONS IN: in 6 functions%3B INVOLVED IN: RNA elongation%2C regulation of transcription%2C DNA-dependent%2C transcription%2C regulation of transcription%3B LOCATED IN: nucleus%3B CONTAINS InterPro DOMAIN/s: Zinc finger%2C TFIIS-type (InterPro:IPR001222)%2C DNA-directed RNA polymerase%2C M/15kDa subunit (InterPro:IPR001529)%2C DNA-directed RNA polymerase%2C subunit M%2C archaeal (InterPro:IPR006288)%2C DNA-directed RNA polymerase M%2C 15kDa subunit%2C conserved site (InterPro:IPR019761)%3B BEST Arabidopsis thaliana protein match is: DNA-directed RNA polymerase%2C subunit M%2C archaeal (TAIR:AT4G07950.1)%3B Has 1129 Blast hits to 1129 proteins in 326 species: Archae - 242%3B Bacteria - 0%3B Metazoa - 276%3B Fungi - 294%3B Plants - 112%3B Viruses - 0%3B Other Eukaryotes - 205 (source: NCBI BLink).; locus_type=protein_coding LOCN Intron COOR W/88977-89081,89173-89263,89405-89529