CLON SALKseq_41055.2  T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG CHRO chr1 EVAL 0 COOR C/63103-63103 NOTE KO443844 Salk 50K 1:62916 CGAAAACTAACGTCAATAGCTTTTACTGTATCCAACAATATCTTCGGAGGCGTTTTCCCCAGGATATATTGTGGTGTA HITS AT1G01130.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01130.1 CDS ID=AT1G01130.1; Parent=AT1G01130; Name=AT1G01130.1; Note=CBL-interacting Serine/Threonine-kinase; conf_class=3; computational_description=CONTAINS InterPro DOMAIN/s: CBL-interacting protein kinase (InterPro:IPR020660)%2C Calcium/calmodulin-dependent protein kinase-like (InterPro:IPR020636)%3B BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G47170.1)%3B Has 176 Blast hits to 176 proteins in 20 species: Archae - 0%3B Bacteria - 0%3B Metazoa - 0%3B Fungi - 0%3B Plants - 176%3B Viruses - 0%3B Other Eukaryotes - 0 (source: NCBI BLink).; conf_rating=****; Dbxref=PMID:15703057, PMID:20226671, locus:2035357; locus_type=protein_coding LOCN Intron COOR C/61905-61949,62050-62124,63557-63811