CLON SALKseq_36285.2  T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG CHRO chr1 EVAL 0 COOR W/52817-52817 NOTE KO449562 Salk 40K 1:52816 GAAATCCCAATCTTTTAAATGGTAGATCTTGTATAAGCAATGTTAATTTTATAGACATAGACAACTTAATAACACATT HITS AT1G01110.2[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01110.2 CDS ID=AT1G01110.2; Parent=AT1G01110; Name=AT1G01110.2; Note=IQ-domain 18; conf_class=2; symbol=IQD18; full_name=IQ-domain 18; computational_description=IQ-domain 18 (IQD18)%3B FUNCTIONS IN: molecular_function unknown%3B LOCATED IN: mitochondrion%3B EXPRESSED IN: 10 plant structures%3B EXPRESSED DURING: 6 growth stages%3B BEST Arabidopsis thaliana protein match is: IQ-domain 17 (TAIR:AT4G00820.1)%3B Has 1112 Blast hits to 678 proteins in 50 species: Archae - 0%3B Bacteria - 10%3B Metazoa - 109%3B Fungi - 16%3B Plants - 528%3B Viruses - 4%3B Other Eukaryotes - 445 (source: NCBI BLink).; conf_rating=****; Dbxref=PMID:15703057, PMID:16368012, PMID:17551672, locus:2200945; locus_type=protein_coding LOCN Intron COOR W/52239-52346,52434-52730,52938-53183,53484-53624,53703-54494 HITS AT1G01110.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01110.1 CDS ID=AT1G01110.1; Parent=AT1G01110; Name=AT1G01110.1; Note=IQ-domain 18; conf_class=1; symbol=IQD18; full_name=IQ-domain 18; computational_description=IQ-domain 18 (IQD18)%3B FUNCTIONS IN: molecular_function unknown%3B LOCATED IN: mitochondrion%3B EXPRESSED IN: 10 plant structures%3B EXPRESSED DURING: 6 growth stages%3B BEST Arabidopsis thaliana protein match is: IQ-domain 17 (TAIR:AT4G00820.1)%3B Has 1112 Blast hits to 678 proteins in 50 species: Archae - 0%3B Bacteria - 10%3B Metazoa - 109%3B Fungi - 16%3B Plants - 528%3B Viruses - 4%3B Other Eukaryotes - 445 (source: NCBI BLink).; conf_rating=*****; Dbxref=PMID:15703057, PMID:16368012, PMID:17551672, locus:2200945; locus_type=protein_coding LOCN 300-UTR5 COOR W/53022-53183,53484-53624,53703-54494