CLON SALKseq_143.1  T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG CHRO chr1 EVAL 0 COOR C/47354-47354 NOTE KO449038 Salk 10K 1:47355 AGAAGTCTGCAAATCTTGAGGTTTAAAGCTATATTATAAGCAAGCTATGCAGAGATGAAGCAAACAAATTGACGCTTAG HITS AT1G01080.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01080.1 CDS ID=AT1G01080.1; Parent=AT1G01080; Name=AT1G01080.1; Note=RNA-binding (RRM/RBD/RNP motifs) family protein; conf_class=2; computational_description=RNA-binding (RRM/RBD/RNP motifs) family protein%3B FUNCTIONS IN: RNA binding%2C nucleotide binding%2C nucleic acid binding%3B INVOLVED IN: biological_process unknown%3B LOCATED IN: chloroplast stroma%2C nucleus%2C chloroplast%2C chloroplast envelope%3B EXPRESSED IN: 23 plant structures%3B EXPRESSED DURING: 13 growth stages%3B CONTAINS InterPro DOMAIN/s: RNA recognition motif%2C RNP-1 (InterPro:IPR000504)%2C Nucleotide-binding%2C alpha-beta plait (InterPro:IPR012677)%3B BEST Arabidopsis thaliana protein match is: RNA-binding (RRM/RBD/RNP motifs) family protein (TAIR:AT1G60000.1)%3B Has 509067 Blast hits to 499893 proteins in 22124 species: Archae - 10819%3B Bacteria - 303967%3B Metazoa - 99035%3B Fungi - 14863%3B Plants - 31737%3B Viruses - 35534%3B Other Eukaryotes - 13112 (source: NCBI BLink).; conf_rating=****; Dbxref=PMID:14576160, PMID:15703057, PMID:18650403, locus:2200975; locus_type=protein_coding LOCN 1000-Promotor COOR C/45503-45559,45646-45954,46044-46145,46376-46789 HITS AT1G01080.2[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01080.2 CDS ID=AT1G01080.2; Parent=AT1G01080; Name=AT1G01080.2; Note=RNA-binding (RRM/RBD/RNP motifs) family protein; conf_class=2; computational_description=RNA-binding (RRM/RBD/RNP motifs) family protein%3B FUNCTIONS IN: RNA binding%2C nucleotide binding%2C nucleic acid binding%3B INVOLVED IN: biological_process unknown%3B LOCATED IN: chloroplast stroma%2C nucleus%2C chloroplast%2C chloroplast envelope%3B EXPRESSED IN: 23 plant structures%3B EXPRESSED DURING: 13 growth stages%3B CONTAINS InterPro DOMAIN/s: RNA recognition motif%2C RNP-1 (InterPro:IPR000504)%2C Nucleotide-binding%2C alpha-beta plait (InterPro:IPR012677)%3B BEST Arabidopsis thaliana protein match is: RNA-binding (RRM/RBD/RNP motifs) family protein (TAIR:AT1G60000.1)%3B Has 509067 Blast hits to 499893 proteins in 22124 species: Archae - 10819%3B Bacteria - 303967%3B Metazoa - 99035%3B Fungi - 14863%3B Plants - 31737%3B Viruses - 35534%3B Other Eukaryotes - 13112 (source: NCBI BLink).; conf_rating=****; Dbxref=PMID:14576160, PMID:15703057, PMID:18650403, locus:2200975; locus_type=protein_coding LOCN 1000-Promotor COOR C/45503-45559,45646-45954,46044-46145,46373-46789 HITS AT1G01080.3[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01080.3 CDS ID=AT1G01080.3; Parent=AT1G01080; Name=AT1G01080.3; Note=RNA-binding (RRM/RBD/RNP motifs) family protein; computational_description=RNA-binding (RRM/RBD/RNP motifs) family protein%3B FUNCTIONS IN: RNA binding%2C nucleotide binding%2C nucleic acid binding%3B INVOLVED IN: biological_process unknown%3B LOCATED IN: chloroplast stroma%2C nucleus%2C chloroplast%2C chloroplast envelope%3B EXPRESSED IN: 23 plant structures%3B EXPRESSED DURING: 13 growth stages%3B CONTAINS InterPro DOMAIN/s: RNA recognition motif%2C RNP-1 (InterPro:IPR000504)%2C Nucleotide-binding%2C alpha-beta plait (InterPro:IPR012677)%3B BEST Arabidopsis thaliana protein match is: RNA-binding (RRM/RBD/RNP motifs) family protein (TAIR:AT1G60000.1)%3B Has 509067 Blast hits to 499893 proteins in 22124 species: Archae - 10819%3B Bacteria - 303967%3B Metazoa - 99035%3B Fungi - 14863%3B Plants - 31737%3B Viruses - 35534%3B Other Eukaryotes - 13112 (source: NCBI BLink).; Dbxref=PMID:14576160, PMID:15703057, PMID:18650403, locus:2200975; locus_type=protein_coding LOCN 1000-Promotor COOR C/45610-45954,46044-46145,46376-46789