CLON SALKseq_136918.1  T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG CHRO chr1 EVAL 0 COOR C/33761-33761 NOTE KO343992 Salk 80K 1:33761 CATTATAAACTATTTATGATCTCATCAATCAATATCCACAATTTTTAAAAAGAAGAATAAAGACAAATCCATTGCTTA HITS AT1G01060.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01060.1 CDS ID=AT1G01060.1; Parent=AT1G01060; Name=AT1G01060.1; Note=Homeodomain-like superfamily protein; curator_summary=LHY encodes a myb-related putative transcription factor involved in circadian rhythm along with another myb transcription factor CCA1; conf_class=3; symbol=LHY; Alias=LHY1, LATE ELONGATED HYPOCOTYL 1; full_name=LATE ELONGATED HYPOCOTYL; computational_description=LATE ELONGATED HYPOCOTYL (LHY)%3B CONTAINS InterPro DOMAIN/s: SANT%2C DNA-binding (InterPro:IPR001005)%2C Homeodomain-like (InterPro:IPR009057)%2C Myb%2C DNA-binding (InterPro:IPR014778)%2C HTH transcriptional regulator%2C Myb-type%2C DNA-binding (InterPro:IPR017930)%2C Myb-like DNA-binding domain%2C SHAQKYF class (InterPro:IPR006447)%3B BEST Arabidopsis thaliana protein match is: circadian clock associated 1 (TAIR:AT2G46830.1)%3B Has 2469 Blast hits to 2022 proteins in 280 species: Archae - 2%3B Bacteria - 257%3B Metazoa - 292%3B Fungi - 162%3B Plants - 1048%3B Viruses - 29%3B Other Eukaryotes - 679 (source: NCBI BLink).; conf_rating=****; Dbxref=PMID:10645431, PMID:10535927, PMID:10477524, PMID:10469647, PMID:10097183, PMID:10023572, PMID:9657154, PMID:9657153, PMID:11118137, PMID:11158533, PMID:11486091, PMID:11402160, PMID:12015970, PMID:12007421, PMID:12068102, PMID:12096093, PMID:11828023, PMID:12198185, PMID:12461138, PMID:12509533, PMID:12574129, PMID:12668783, PMID:12777053, PMID:14563930, PMID:14558659, PMID:14523250, PMID:14634162, PMID:14741378, PMID:15310821, PMID:15649364, PMID:15734916, PMID:15767265, PMID:15923346, PMID:16006578, PMID:16212608, PMID:16463103, PMID:16524874, PMID:16617099, PMID:17132630, PMID:17122071, PMID:17098855, PMID:17363273, PMID:17468223, PMID:17519251, PMID:17504813, PMID:17496120, PMID:17483414, PMID:17587236, PMID:17540692, PMID:17616736, PMID:17877705, PMID:17982000, PMID:18182014, PMID:18178585, PMID:18281507, PMID:18281417, PMID:18480377, PMID:18650403, PMID:18707796, PMID:18676661, PMID:19011118, PMID:19098071, PMID:19095940, PMID:19060255, PMID:19218364, PMID:19297549, PMID:19286557, PMID:19339503, PMID:19542296, PMID:15725674, PMID:15988568, PMID:16729048, PMID:16709197, PMID:17102804, PMID:18460819, PMID:19029881, PMID:19140936, PMID:19383102, PMID:19380736, PMID:19624471, PMID:19843842, PMID:19820331, PMID:19805390, PMID:19789276, PMID:20154425, PMID:20119844, PMID:20335405, PMID:20233950, PMID:20354196, PMID:20439704, PMID:20433765, PMID:20599732, PMID:20736450, PMID:21098730, PMID:21183706, PMID:21139085, PMID:21205033, PMID:21196476, PMID:21236675, PMID:21331777, PMID:21296763, PMID:21447790, PMID:21454289, PMID:21499259, PMID:21483796, PMID:21471455, PMID:21848684, PMID:21822060, PMID:21884973, PMID:21884969, PMID:22353866, PMID:22315425, PMID:22311777, PMID:22408072, PMID:22395476, PMID:22715042, PMID:22672153, PMID:22899064, PMID:22878891, PMID:23006446, PMID:22995285, PMID:23107921, PMID:23144785, PMID:23128602, PMID:23307650, PMID:23511208, PMID:23555221, PMID:23645632, PMID:23777196, PMID:23754942, PMID:23506153, PMID:23933882, PMID:23830866, PMID:24377444, PMID:24484962, PMID:24792048, PMID:25264899, locus:2200970; locus_type=protein_coding LOCN 300-UTR3 COOR C/33992-34327,34401-35474,35567-35647,35730-35963,36624-36685,36810-36921,37023-37061 HITS AT1G01060.2[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01060.2 CDS ID=AT1G01060.2; Parent=AT1G01060; Name=AT1G01060.2; Note=Homeodomain-like superfamily protein; curator_summary=LHY encodes a myb-related putative transcription factor involved in circadian rhythm along with another myb transcription factor CCA1; conf_class=2; symbol=LHY; Alias=LHY1, LATE ELONGATED HYPOCOTYL 1; full_name=LATE ELONGATED HYPOCOTYL; computational_description=LATE ELONGATED HYPOCOTYL (LHY)%3B CONTAINS InterPro DOMAIN/s: SANT%2C DNA-binding (InterPro:IPR001005)%2C Homeodomain-like (InterPro:IPR009057)%2C Myb%2C DNA-binding (InterPro:IPR014778)%2C HTH transcriptional regulator%2C Myb-type%2C DNA-binding (InterPro:IPR017930)%2C Myb-like DNA-binding domain%2C SHAQKYF class (InterPro:IPR006447)%3B BEST Arabidopsis thaliana protein match is: circadian clock associated 1 (TAIR:AT2G46830.1)%3B Has 2469 Blast hits to 2022 proteins in 280 species: Archae - 2%3B Bacteria - 257%3B Metazoa - 292%3B Fungi - 162%3B Plants - 1048%3B Viruses - 29%3B Other Eukaryotes - 679 (source: NCBI BLink).; conf_rating=****; Dbxref=PMID:10645431, PMID:10535927, PMID:10477524, PMID:10469647, PMID:10097183, PMID:10023572, PMID:9657154, PMID:9657153, PMID:11118137, PMID:11158533, PMID:11486091, PMID:11402160, PMID:12015970, PMID:12007421, PMID:12068102, PMID:12096093, PMID:11828023, PMID:12198185, PMID:12461138, PMID:12509533, PMID:12574129, PMID:12668783, PMID:12777053, PMID:14563930, PMID:14558659, PMID:14523250, PMID:14634162, PMID:14741378, PMID:15310821, PMID:15649364, PMID:15734916, PMID:15767265, PMID:15923346, PMID:16006578, PMID:16212608, PMID:16463103, PMID:16524874, PMID:16617099, PMID:17132630, PMID:17122071, PMID:17098855, PMID:17363273, PMID:17468223, PMID:17519251, PMID:17504813, PMID:17496120, PMID:17483414, PMID:17587236, PMID:17540692, PMID:17616736, PMID:17877705, PMID:17982000, PMID:18182014, PMID:18178585, PMID:18281507, PMID:18281417, PMID:18480377, PMID:18650403, PMID:18707796, PMID:18676661, PMID:19011118, PMID:19098071, PMID:19095940, PMID:19060255, PMID:19218364, PMID:19297549, PMID:19286557, PMID:19339503, PMID:19542296, PMID:15725674, PMID:15988568, PMID:16729048, PMID:16709197, PMID:17102804, PMID:18460819, PMID:19029881, PMID:19140936, PMID:19383102, PMID:19380736, PMID:19624471, PMID:19843842, PMID:19820331, PMID:19805390, PMID:19789276, PMID:20154425, PMID:20119844, PMID:20335405, PMID:20233950, PMID:20354196, PMID:20439704, PMID:20433765, PMID:20599732, PMID:20736450, PMID:21098730, PMID:21183706, PMID:21139085, PMID:21205033, PMID:21196476, PMID:21236675, PMID:21331777, PMID:21296763, PMID:21447790, PMID:21454289, PMID:21499259, PMID:21483796, PMID:21471455, PMID:21848684, PMID:21822060, PMID:21884973, PMID:21884969, PMID:22353866, PMID:22315425, PMID:22311777, PMID:22408072, PMID:22395476, PMID:22715042, PMID:22672153, PMID:22899064, PMID:22878891, PMID:23006446, PMID:22995285, PMID:23107921, PMID:23144785, PMID:23128602, PMID:23307650, PMID:23511208, PMID:23555221, PMID:23645632, PMID:23777196, PMID:23754942, PMID:23506153, PMID:23933882, PMID:23830866, PMID:24377444, PMID:24484962, PMID:24792048, PMID:25264899, locus:2200970; locus_type=protein_coding LOCN 300-UTR3 COOR C/33992-34327,34401-35474,35567-35647,35730-35963,36624-36685,36810-36921,37023-37061 HITS AT1G01060.3[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01060.3 CDS ID=AT1G01060.3; Parent=AT1G01060; Name=AT1G01060.3; Note=Homeodomain-like superfamily protein; curator_summary=LHY encodes a myb-related putative transcription factor involved in circadian rhythm along with another myb transcription factor CCA1; conf_class=2; symbol=LHY; Alias=LHY1, LATE ELONGATED HYPOCOTYL 1; full_name=LATE ELONGATED HYPOCOTYL; computational_description=LATE ELONGATED HYPOCOTYL (LHY)%3B CONTAINS InterPro DOMAIN/s: SANT%2C DNA-binding (InterPro:IPR001005)%2C Homeodomain-like (InterPro:IPR009057)%2C Myb%2C DNA-binding (InterPro:IPR014778)%2C HTH transcriptional regulator%2C Myb-type%2C DNA-binding (InterPro:IPR017930)%2C Myb-like DNA-binding domain%2C SHAQKYF class (InterPro:IPR006447)%3B BEST Arabidopsis thaliana protein match is: circadian clock associated 1 (TAIR:AT2G46830.1)%3B Has 2469 Blast hits to 2022 proteins in 280 species: Archae - 2%3B Bacteria - 257%3B Metazoa - 292%3B Fungi - 162%3B Plants - 1048%3B Viruses - 29%3B Other Eukaryotes - 679 (source: NCBI BLink).; conf_rating=****; Dbxref=PMID:10645431, PMID:10535927, PMID:10477524, PMID:10469647, PMID:10097183, PMID:10023572, PMID:9657154, PMID:9657153, PMID:11118137, PMID:11158533, PMID:11486091, PMID:11402160, PMID:12015970, PMID:12007421, PMID:12068102, PMID:12096093, PMID:11828023, PMID:12198185, PMID:12461138, PMID:12509533, PMID:12574129, PMID:12668783, PMID:12777053, PMID:14563930, PMID:14558659, PMID:14523250, PMID:14634162, PMID:14741378, PMID:15310821, PMID:15649364, PMID:15734916, PMID:15767265, PMID:15923346, PMID:16006578, PMID:16212608, PMID:16463103, PMID:16524874, PMID:16617099, PMID:17132630, PMID:17122071, PMID:17098855, PMID:17363273, PMID:17468223, PMID:17519251, PMID:17504813, PMID:17496120, PMID:17483414, PMID:17587236, PMID:17540692, PMID:17616736, PMID:17877705, PMID:17982000, PMID:18182014, PMID:18178585, PMID:18281507, PMID:18281417, PMID:18480377, PMID:18650403, PMID:18707796, PMID:18676661, PMID:19011118, PMID:19098071, PMID:19095940, PMID:19060255, PMID:19218364, PMID:19297549, PMID:19286557, PMID:19339503, PMID:19542296, PMID:15725674, PMID:15988568, PMID:16729048, PMID:16709197, PMID:17102804, PMID:18460819, PMID:19029881, PMID:19140936, PMID:19383102, PMID:19380736, PMID:19624471, PMID:19843842, PMID:19820331, PMID:19805390, PMID:19789276, PMID:20154425, PMID:20119844, PMID:20335405, PMID:20233950, PMID:20354196, PMID:20439704, PMID:20433765, PMID:20599732, PMID:20736450, PMID:21098730, PMID:21183706, PMID:21139085, PMID:21205033, PMID:21196476, PMID:21236675, PMID:21331777, PMID:21296763, PMID:21447790, PMID:21454289, PMID:21499259, PMID:21483796, PMID:21471455, PMID:21848684, PMID:21822060, PMID:21884973, PMID:21884969, PMID:22353866, PMID:22315425, PMID:22311777, PMID:22408072, PMID:22395476, PMID:22715042, PMID:22672153, PMID:22899064, PMID:22878891, PMID:23006446, PMID:22995285, PMID:23107921, PMID:23144785, PMID:23128602, PMID:23307650, PMID:23511208, PMID:23555221, PMID:23645632, PMID:23777196, PMID:23754942, PMID:23506153, PMID:23933882, PMID:23830866, PMID:24377444, PMID:24484962, PMID:24792048, PMID:25264899, locus:2200970; locus_type=protein_coding LOCN 300-UTR3 COOR C/33992-34327,34401-35474,35567-35647,35730-35963,36624-36685,36810-36921,37023-37061 HITS AT1G01060.4[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01060.4 CDS ID=AT1G01060.4; Parent=AT1G01060; Name=AT1G01060.4; Note=Homeodomain-like superfamily protein; curator_summary=LHY encodes a myb-related putative transcription factor involved in circadian rhythm along with another myb transcription factor CCA1; conf_class=2; symbol=LHY; Alias=LHY1, LATE ELONGATED HYPOCOTYL 1; full_name=LATE ELONGATED HYPOCOTYL; computational_description=LATE ELONGATED HYPOCOTYL (LHY)%3B CONTAINS InterPro DOMAIN/s: SANT%2C DNA-binding (InterPro:IPR001005)%2C Homeodomain-like (InterPro:IPR009057)%2C Myb%2C DNA-binding (InterPro:IPR014778)%2C HTH transcriptional regulator%2C Myb-type%2C DNA-binding (InterPro:IPR017930)%2C Myb-like DNA-binding domain%2C SHAQKYF class (InterPro:IPR006447)%3B BEST Arabidopsis thaliana protein match is: circadian clock associated 1 (TAIR:AT2G46830.1)%3B Has 2469 Blast hits to 2022 proteins in 280 species: Archae - 2%3B Bacteria - 257%3B Metazoa - 292%3B Fungi - 162%3B Plants - 1048%3B Viruses - 29%3B Other Eukaryotes - 679 (source: NCBI BLink).; conf_rating=****; Dbxref=PMID:10645431, PMID:10535927, PMID:10477524, PMID:10469647, PMID:10097183, PMID:10023572, PMID:9657154, PMID:9657153, PMID:11118137, PMID:11158533, PMID:11486091, PMID:11402160, PMID:12015970, PMID:12007421, PMID:12068102, PMID:12096093, PMID:11828023, PMID:12198185, PMID:12461138, PMID:12509533, PMID:12574129, PMID:12668783, PMID:12777053, PMID:14563930, PMID:14558659, PMID:14523250, PMID:14634162, PMID:14741378, PMID:15310821, PMID:15649364, PMID:15734916, PMID:15767265, PMID:15923346, PMID:16006578, PMID:16212608, PMID:16463103, PMID:16524874, PMID:16617099, PMID:17132630, PMID:17122071, PMID:17098855, PMID:17363273, PMID:17468223, PMID:17519251, PMID:17504813, PMID:17496120, PMID:17483414, PMID:17587236, PMID:17540692, PMID:17616736, PMID:17877705, PMID:17982000, PMID:18182014, PMID:18178585, PMID:18281507, PMID:18281417, PMID:18480377, PMID:18650403, PMID:18707796, PMID:18676661, PMID:19011118, PMID:19098071, PMID:19095940, PMID:19060255, PMID:19218364, PMID:19297549, PMID:19286557, PMID:19339503, PMID:19542296, PMID:15725674, PMID:15988568, PMID:16729048, PMID:16709197, PMID:17102804, PMID:18460819, PMID:19029881, PMID:19140936, PMID:19383102, PMID:19380736, PMID:19624471, PMID:19843842, PMID:19820331, PMID:19805390, PMID:19789276, PMID:20154425, PMID:20119844, PMID:20335405, PMID:20233950, PMID:20354196, PMID:20439704, PMID:20433765, PMID:20599732, PMID:20736450, PMID:21098730, PMID:21183706, PMID:21139085, PMID:21205033, PMID:21196476, PMID:21236675, PMID:21331777, PMID:21296763, PMID:21447790, PMID:21454289, PMID:21499259, PMID:21483796, PMID:21471455, PMID:21848684, PMID:21822060, PMID:21884973, PMID:21884969, PMID:22353866, PMID:22315425, PMID:22311777, PMID:22408072, PMID:22395476, PMID:22715042, PMID:22672153, PMID:22899064, PMID:22878891, PMID:23006446, PMID:22995285, PMID:23107921, PMID:23144785, PMID:23128602, PMID:23307650, PMID:23511208, PMID:23555221, PMID:23645632, PMID:23777196, PMID:23754942, PMID:23506153, PMID:23933882, PMID:23830866, PMID:24377444, PMID:24484962, PMID:24792048, PMID:25264899, locus:2200970; locus_type=protein_coding LOCN 300-UTR3 COOR C/33992-34327,34401-35471,35567-35647,35730-35963,36624-36685,36810-36921,37023-37061 HITS AT1G01060.5[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01060.5 CDS ID=AT1G01060.5; Parent=AT1G01060; Name=AT1G01060.5; Note=Homeodomain-like superfamily protein; curator_summary=LHY encodes a myb-related putative transcription factor involved in circadian rhythm along with another myb transcription factor CCA1; conf_class=6; symbol=LHY; Alias=LHY1, LATE ELONGATED HYPOCOTYL 1; full_name=LATE ELONGATED HYPOCOTYL; computational_description=LATE ELONGATED HYPOCOTYL (LHY)%3B CONTAINS InterPro DOMAIN/s: SANT%2C DNA-binding (InterPro:IPR001005)%2C Homeodomain-like (InterPro:IPR009057)%2C Myb%2C DNA-binding (InterPro:IPR014778)%2C HTH transcriptional regulator%2C Myb-type%2C DNA-binding (InterPro:IPR017930)%2C Myb-like DNA-binding domain%2C SHAQKYF class (InterPro:IPR006447)%3B BEST Arabidopsis thaliana protein match is: circadian clock associated 1 (TAIR:AT2G46830.1)%3B Has 2469 Blast hits to 2022 proteins in 280 species: Archae - 2%3B Bacteria - 257%3B Metazoa - 292%3B Fungi - 162%3B Plants - 1048%3B Viruses - 29%3B Other Eukaryotes - 679 (source: NCBI BLink).; conf_rating=**; Dbxref=PMID:10645431, PMID:10535927, PMID:10477524, PMID:10469647, PMID:10097183, PMID:10023572, PMID:9657154, PMID:9657153, PMID:11118137, PMID:11158533, PMID:11486091, PMID:11402160, PMID:12015970, PMID:12007421, PMID:12068102, PMID:12096093, PMID:11828023, PMID:12198185, PMID:12461138, PMID:12509533, PMID:12574129, PMID:12668783, PMID:12777053, PMID:14563930, PMID:14558659, PMID:14523250, PMID:14634162, PMID:14741378, PMID:15310821, PMID:15649364, PMID:15734916, PMID:15767265, PMID:15923346, PMID:16006578, PMID:16212608, PMID:16463103, PMID:16524874, PMID:16617099, PMID:17132630, PMID:17122071, PMID:17098855, PMID:17363273, PMID:17468223, PMID:17519251, PMID:17504813, PMID:17496120, PMID:17483414, PMID:17587236, PMID:17540692, PMID:17616736, PMID:17877705, PMID:17982000, PMID:18182014, PMID:18178585, PMID:18281507, PMID:18281417, PMID:18480377, PMID:18650403, PMID:18707796, PMID:18676661, PMID:19011118, PMID:19098071, PMID:19095940, PMID:19060255, PMID:19218364, PMID:19297549, PMID:19286557, PMID:19339503, PMID:19542296, PMID:15725674, PMID:15988568, PMID:16729048, PMID:16709197, PMID:17102804, PMID:18460819, PMID:19029881, PMID:19140936, PMID:19383102, PMID:19380736, PMID:19624471, PMID:19843842, PMID:19820331, PMID:19805390, PMID:19789276, PMID:20154425, PMID:20119844, PMID:20335405, PMID:20233950, PMID:20354196, PMID:20439704, PMID:20433765, PMID:20599732, PMID:20736450, PMID:21098730, PMID:21183706, PMID:21139085, PMID:21205033, PMID:21196476, PMID:21236675, PMID:21331777, PMID:21296763, PMID:21447790, PMID:21454289, PMID:21499259, PMID:21483796, PMID:21471455, PMID:21848684, PMID:21822060, PMID:21884973, PMID:21884969, PMID:22353866, PMID:22315425, PMID:22311777, PMID:22408072, PMID:22395476, PMID:22715042, PMID:22672153, PMID:22899064, PMID:22878891, PMID:23006446, PMID:22995285, PMID:23107921, PMID:23144785, PMID:23128602, PMID:23307650, PMID:23511208, PMID:23555221, PMID:23645632, PMID:23777196, PMID:23754942, PMID:23506153, PMID:23933882, PMID:23830866, PMID:24377444, PMID:24484962, PMID:24792048, PMID:25264899, locus:2200970; locus_type=protein_coding LOCN 300-UTR3 COOR C/33992-34327,34401-35474,35567-35647,35730-35999,36090-36171,36624-36685,36810-36836 HITS AT1G01060.6[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01060.6 CDS ID=AT1G01060.6; Parent=AT1G01060; Name=AT1G01060.6; Note=Homeodomain-like superfamily protein; symbol=LHY; Alias=LHY1, LATE ELONGATED HYPOCOTYL 1; full_name=LATE ELONGATED HYPOCOTYL; Dbxref=PMID:10645431, PMID:10535927, PMID:10477524, PMID:10469647, PMID:10097183, PMID:10023572, PMID:9657154, PMID:9657153, PMID:11118137, PMID:11158533, PMID:11486091, PMID:11402160, PMID:12015970, PMID:12007421, PMID:12068102, PMID:12096093, PMID:11828023, PMID:12198185, PMID:12461138, PMID:12509533, PMID:12574129, PMID:12668783, PMID:12777053, PMID:14563930, PMID:14558659, PMID:14523250, PMID:14634162, PMID:14741378, PMID:15310821, PMID:15649364, PMID:15734916, PMID:15767265, PMID:15923346, PMID:16006578, PMID:16212608, PMID:16463103, PMID:16524874, PMID:16617099, PMID:17132630, PMID:17122071, PMID:17098855, PMID:17363273, PMID:17468223, PMID:17519251, PMID:17504813, PMID:17496120, PMID:17483414, PMID:17587236, PMID:17540692, PMID:17616736, PMID:17877705, PMID:17982000, PMID:18182014, PMID:18178585, PMID:18281507, PMID:18281417, PMID:18480377, PMID:18650403, PMID:18707796, PMID:18676661, PMID:19011118, PMID:19098071, PMID:19095940, PMID:19060255, PMID:19218364, PMID:19297549, PMID:19286557, PMID:19339503, PMID:19542296, PMID:15725674, PMID:15988568, PMID:16729048, PMID:16709197, PMID:17102804, PMID:18460819, PMID:19029881, PMID:19140936, PMID:19383102, PMID:19380736, PMID:19624471, PMID:19843842, PMID:19820331, PMID:19805390, PMID:19789276, PMID:20154425, PMID:20119844, PMID:20335405, PMID:20233950, PMID:20354196, PMID:20439704, PMID:20433765, PMID:20599732, PMID:20736450, PMID:21098730, PMID:21183706, PMID:21139085, PMID:21205033, PMID:21196476, PMID:21236675, PMID:21331777, PMID:21296763, PMID:21447790, PMID:21454289, PMID:21499259, PMID:21483796, PMID:21471455, PMID:21848684, PMID:21822060, PMID:21884973, PMID:21884969, PMID:22353866, PMID:22315425, PMID:22311777, PMID:22408072, PMID:22395476, PMID:22715042, PMID:22672153, PMID:22899064, PMID:22878891, PMID:23006446, PMID:22995285, PMID:23107921, PMID:23144785, PMID:23128602, PMID:23307650, PMID:23511208, PMID:23555221, PMID:23645632, PMID:23777196, PMID:23754942, PMID:23506153, PMID:23933882, PMID:23830866, PMID:24377444, PMID:24484962, PMID:24792048, PMID:25264899, locus:2200970; curator_summary=LHY encodes a myb-related putative transcription factor involved in circadian rhythm along with another myb transcription factor CCA1; computational_description=LATE ELONGATED HYPOCOTYL (LHY)%3B CONTAINS InterPro DOMAIN/s: SANT%2C DNA-binding (InterPro:IPR001005)%2C Homeodomain-like (InterPro:IPR009057)%2C Myb%2C DNA-binding (InterPro:IPR014778)%2C HTH transcriptional regulator%2C Myb-type%2C DNA-binding (InterPro:IPR017930)%2C Myb-like DNA-binding domain%2C SHAQKYF class (InterPro:IPR006447)%3B BEST Arabidopsis thaliana protein match is: circadian clock associated 1 (TAIR:AT2G46830.1)%3B Has 2469 Blast hits to 2022 proteins in 280 species: Archae - 2%3B Bacteria - 257%3B Metazoa - 292%3B Fungi - 162%3B Plants - 1048%3B Viruses - 29%3B Other Eukaryotes - 679 (source: NCBI BLink).; locus_type=protein_coding LOCN 300-UTR3 COOR C/33992-34327,34401-35474,35567-35647,35730-35999,36090-36171,36624-36685,36810-36836 HITS AT1G01060.7[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01060.7 CDS ID=AT1G01060.7; Parent=AT1G01060; Name=AT1G01060.7; Note=Homeodomain-like superfamily protein; symbol=LHY; Alias=LHY1, LATE ELONGATED HYPOCOTYL 1; full_name=LATE ELONGATED HYPOCOTYL; Dbxref=PMID:10645431, PMID:10535927, PMID:10477524, PMID:10469647, PMID:10097183, PMID:10023572, PMID:9657154, PMID:9657153, PMID:11118137, PMID:11158533, PMID:11486091, PMID:11402160, PMID:12015970, PMID:12007421, PMID:12068102, PMID:12096093, PMID:11828023, PMID:12198185, PMID:12461138, PMID:12509533, PMID:12574129, PMID:12668783, PMID:12777053, PMID:14563930, PMID:14558659, PMID:14523250, PMID:14634162, PMID:14741378, PMID:15310821, PMID:15649364, PMID:15734916, PMID:15767265, PMID:15923346, PMID:16006578, PMID:16212608, PMID:16463103, PMID:16524874, PMID:16617099, PMID:17132630, PMID:17122071, PMID:17098855, PMID:17363273, PMID:17468223, PMID:17519251, PMID:17504813, PMID:17496120, PMID:17483414, PMID:17587236, PMID:17540692, PMID:17616736, PMID:17877705, PMID:17982000, PMID:18182014, PMID:18178585, PMID:18281507, PMID:18281417, PMID:18480377, PMID:18650403, PMID:18707796, PMID:18676661, PMID:19011118, PMID:19098071, PMID:19095940, PMID:19060255, PMID:19218364, PMID:19297549, PMID:19286557, PMID:19339503, PMID:19542296, PMID:15725674, PMID:15988568, PMID:16729048, PMID:16709197, PMID:17102804, PMID:18460819, PMID:19029881, PMID:19140936, PMID:19383102, PMID:19380736, PMID:19624471, PMID:19843842, PMID:19820331, PMID:19805390, PMID:19789276, PMID:20154425, PMID:20119844, PMID:20335405, PMID:20233950, PMID:20354196, PMID:20439704, PMID:20433765, PMID:20599732, PMID:20736450, PMID:21098730, PMID:21183706, PMID:21139085, PMID:21205033, PMID:21196476, PMID:21236675, PMID:21331777, PMID:21296763, PMID:21447790, PMID:21454289, PMID:21499259, PMID:21483796, PMID:21471455, PMID:21848684, PMID:21822060, PMID:21884973, PMID:21884969, PMID:22353866, PMID:22315425, PMID:22311777, PMID:22408072, PMID:22395476, PMID:22715042, PMID:22672153, PMID:22899064, PMID:22878891, PMID:23006446, PMID:22995285, PMID:23107921, PMID:23144785, PMID:23128602, PMID:23307650, PMID:23511208, PMID:23555221, PMID:23645632, PMID:23777196, PMID:23754942, PMID:23506153, PMID:23933882, PMID:23830866, PMID:24377444, PMID:24484962, PMID:24792048, PMID:25264899, locus:2200970; curator_summary=LHY encodes a myb-related putative transcription factor involved in circadian rhythm along with another myb transcription factor CCA1; computational_description=LATE ELONGATED HYPOCOTYL (LHY)%3B CONTAINS InterPro DOMAIN/s: SANT%2C DNA-binding (InterPro:IPR001005)%2C Homeodomain-like (InterPro:IPR009057)%2C Myb%2C DNA-binding (InterPro:IPR014778)%2C HTH transcriptional regulator%2C Myb-type%2C DNA-binding (InterPro:IPR017930)%2C Myb-like DNA-binding domain%2C SHAQKYF class (InterPro:IPR006447)%3B BEST Arabidopsis thaliana protein match is: circadian clock associated 1 (TAIR:AT2G46830.1)%3B Has 2469 Blast hits to 2022 proteins in 280 species: Archae - 2%3B Bacteria - 257%3B Metazoa - 292%3B Fungi - 162%3B Plants - 1048%3B Viruses - 29%3B Other Eukaryotes - 679 (source: NCBI BLink).; locus_type=protein_coding LOCN 300-UTR3 COOR C/33992-34327,34401-35474,35567-35647,35730-35963,36624-36685,36810-36921,37023-37061 HITS AT1G01060.8[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01060.8 CDS ID=AT1G01060.8; Parent=AT1G01060; Name=AT1G01060.8; Note=Homeodomain-like superfamily protein; symbol=LHY; Alias=LHY1, LATE ELONGATED HYPOCOTYL 1; full_name=LATE ELONGATED HYPOCOTYL; Dbxref=PMID:10645431, PMID:10535927, PMID:10477524, PMID:10469647, PMID:10097183, PMID:10023572, PMID:9657154, PMID:9657153, PMID:11118137, PMID:11158533, PMID:11486091, PMID:11402160, PMID:12015970, PMID:12007421, PMID:12068102, PMID:12096093, PMID:11828023, PMID:12198185, PMID:12461138, PMID:12509533, PMID:12574129, PMID:12668783, PMID:12777053, PMID:14563930, PMID:14558659, PMID:14523250, PMID:14634162, PMID:14741378, PMID:15310821, PMID:15649364, PMID:15734916, PMID:15767265, PMID:15923346, PMID:16006578, PMID:16212608, PMID:16463103, PMID:16524874, PMID:16617099, PMID:17132630, PMID:17122071, PMID:17098855, PMID:17363273, PMID:17468223, PMID:17519251, PMID:17504813, PMID:17496120, PMID:17483414, PMID:17587236, PMID:17540692, PMID:17616736, PMID:17877705, PMID:17982000, PMID:18182014, PMID:18178585, PMID:18281507, PMID:18281417, PMID:18480377, PMID:18650403, PMID:18707796, PMID:18676661, PMID:19011118, PMID:19098071, PMID:19095940, PMID:19060255, PMID:19218364, PMID:19297549, PMID:19286557, PMID:19339503, PMID:19542296, PMID:15725674, PMID:15988568, PMID:16729048, PMID:16709197, PMID:17102804, PMID:18460819, PMID:19029881, PMID:19140936, PMID:19383102, PMID:19380736, PMID:19624471, PMID:19843842, PMID:19820331, PMID:19805390, PMID:19789276, PMID:20154425, PMID:20119844, PMID:20335405, PMID:20233950, PMID:20354196, PMID:20439704, PMID:20433765, PMID:20599732, PMID:20736450, PMID:21098730, PMID:21183706, PMID:21139085, PMID:21205033, PMID:21196476, PMID:21236675, PMID:21331777, PMID:21296763, PMID:21447790, PMID:21454289, PMID:21499259, PMID:21483796, PMID:21471455, PMID:21848684, PMID:21822060, PMID:21884973, PMID:21884969, PMID:22353866, PMID:22315425, PMID:22311777, PMID:22408072, PMID:22395476, PMID:22715042, PMID:22672153, PMID:22899064, PMID:22878891, PMID:23006446, PMID:22995285, PMID:23107921, PMID:23144785, PMID:23128602, PMID:23307650, PMID:23511208, PMID:23555221, PMID:23645632, PMID:23777196, PMID:23754942, PMID:23506153, PMID:23933882, PMID:23830866, PMID:24377444, PMID:24484962, PMID:24792048, PMID:25264899, locus:2200970; curator_summary=LHY encodes a myb-related putative transcription factor involved in circadian rhythm along with another myb transcription factor CCA1; computational_description=LATE ELONGATED HYPOCOTYL (LHY)%3B CONTAINS InterPro DOMAIN/s: SANT%2C DNA-binding (InterPro:IPR001005)%2C Homeodomain-like (InterPro:IPR009057)%2C Myb%2C DNA-binding (InterPro:IPR014778)%2C HTH transcriptional regulator%2C Myb-type%2C DNA-binding (InterPro:IPR017930)%2C Myb-like DNA-binding domain%2C SHAQKYF class (InterPro:IPR006447)%3B BEST Arabidopsis thaliana protein match is: circadian clock associated 1 (TAIR:AT2G46830.1)%3B Has 2469 Blast hits to 2022 proteins in 280 species: Archae - 2%3B Bacteria - 257%3B Metazoa - 292%3B Fungi - 162%3B Plants - 1048%3B Viruses - 29%3B Other Eukaryotes - 679 (source: NCBI BLink).; locus_type=protein_coding LOCN 300-UTR3 COOR C/33992-34327,34401-35474,35567-35647,35730-35963,36624-36685,36810-36921,37023-37061