CLON SALKseq_130519.0  T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG CHRO chr1 EVAL 0 COOR W/19874266-19874266 NOTE KO413949 Salk 50K 1:19874265 CTATACAGTAGTATTTTCTTACATTATTTCAGAACCCAAGTACATTATATTAAATTTATTTCAGGATATATTGTGGTGT HITS AT1TE65700[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1TE65700 transposable_element ID=AT1TE65700; Name=AT1TE65700; Alias=ATHATN2 LOCN 1000-Promotor COOR W/19874972-19875199