CLON SALKseq_125158.0  T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG CHRO chr2 EVAL 0 COOR C/16985490-16985490 NOTE KO376901 Salk 60K 2:16985490 GTTTGTACCTTTATCAATGTGCAGATCATTGAATATTGTGTTGCTGTCCCAGTCCAGCATAAGCAGACAATTGAATTGA HITS AT2G40715.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT2G40715.1 CDS ID=AT2G40715.1; Parent=AT2G40715; Name=AT2G40715.1; Note=hypothetical protein; locus_type=protein_coding LOCN Intron COOR C/16983087-16983133,16983496-16983580,16983789-16983968,16984158-16984205,16985765-16985791 HITS AT2G09170.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT2G09170.1 lnc_RNA ID=AT2G09170.1; Parent=AT2G09170; Name=AT2G09170.1; locus_type=long_noncoding_rna LOCN Exon COOR W/16985455-16985736