CLON SALKseq_122548.2  T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG CHRO chr1 EVAL 0 COOR W/39230-39230 NOTE KO363368 Salk 60K 1:39229 TGTGGGTTTTTTTATGTGGTTTTTTTTTATCATATATTATAGGGAGTGGTAGGACAAGCAATGACGACGGTTGCAACAACATGGGGGATTAAAAAATTAG HITS AT1G01070.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01070.1 CDS ID=AT1G01070.1; Parent=AT1G01070; Name=AT1G01070.1; Note=nodulin MtN21 /EamA-like transporter family protein; curator_summary=nodulin MtN21-like transporter family protein; conf_class=2; symbol=UMAMIT28; full_name=Usually multiple acids move in and out Transporters 28; computational_description=nodulin MtN21 /EamA-like transporter family protein%3B LOCATED IN: membrane%3B EXPRESSED IN: 17 plant structures%3B EXPRESSED DURING: 7 growth stages%3B CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF6%2C transmembrane (InterPro:IPR000620)%3B BEST Arabidopsis thaliana protein match is: nodulin MtN21 /EamA-like transporter family protein (TAIR:AT1G11460.1)%3B Has 3211 Blast hits to 3199 proteins in 599 species: Archae - 23%3B Bacteria - 1686%3B Metazoa - 4%3B Fungi - 6%3B Plants - 1233%3B Viruses - 0%3B Other Eukaryotes - 259 (source: NCBI BLink).; conf_rating=****; Dbxref=PMID:15703057, locus:2200990; locus_type=protein_coding LOCN Exon COOR C/38898-39054,39136-39287,39409-39814,40213-40329,40473-40535,40675-40877 HITS AT1G01070.2[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01070.2 CDS ID=AT1G01070.2; Parent=AT1G01070; Name=AT1G01070.2; Note=nodulin MtN21 /EamA-like transporter family protein; curator_summary=nodulin MtN21-like transporter family protein; conf_class=1; symbol=UMAMIT28; full_name=Usually multiple acids move in and out Transporters 28; computational_description=nodulin MtN21 /EamA-like transporter family protein%3B LOCATED IN: membrane%3B EXPRESSED IN: 17 plant structures%3B EXPRESSED DURING: 7 growth stages%3B CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF6%2C transmembrane (InterPro:IPR000620)%3B BEST Arabidopsis thaliana protein match is: nodulin MtN21 /EamA-like transporter family protein (TAIR:AT1G11460.1)%3B Has 3211 Blast hits to 3199 proteins in 599 species: Archae - 23%3B Bacteria - 1686%3B Metazoa - 4%3B Fungi - 6%3B Plants - 1233%3B Viruses - 0%3B Other Eukaryotes - 259 (source: NCBI BLink).; conf_rating=*****; Dbxref=PMID:15703057, locus:2200990; locus_type=protein_coding LOCN Exon COOR C/38898-39054,39136-39287,39409-39814,40213-40329,40473-40597