CLON SALKseq_116171.1  T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG CHRO chr1 EVAL 0 COOR C/67258-67258 NOTE KG793271 Salk 110K 1:67277 AAACATTAACCTTAATAACCGAACACCAACCTAGGAGGACATGTGGGTCCCTAATCACGAAATTAAACTGTTCTTTACGTGACAACTTAATAACACATTG HITS AT1G01140.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01140.1 CDS ID=AT1G01140.1; Parent=AT1G01140; Name=AT1G01140.1; Note=CBL-interacting protein kinase 9; curator_summary=Encodes a CBL-interacting protein kinase with similarity to SOS2; conf_class=2; symbol=CIPK9; Alias=PKS6, PROTEIN KINASE 6, SnRK3.12, SNF1-RELATED PROTEIN KINASE 3.12; full_name=CBL-interacting protein kinase 9; computational_description=CBL-interacting protein kinase 9 (CIPK9)%3B FUNCTIONS IN: protein serine/threonine kinase activity%2C protein kinase activity%2C kinase activity%2C ATP binding%3B INVOLVED IN: in 6 processes%3B EXPRESSED IN: 23 plant structures%3B EXPRESSED DURING: 15 growth stages%3B CONTAINS InterPro DOMAIN/s: Protein kinase%2C ATP binding site (InterPro:IPR017441)%2C NAF/FISL domain (InterPro:IPR018451)%2C Serine/threonine-protein kinase domain (InterPro:IPR002290)%2C Serine/threonine-protein kinase-like domain (InterPro:IPR017442)%2C Protein kinase-like domain (InterPro:IPR011009)%2C Serine/threonine-protein kinase%2C active site (InterPro:IPR008271)%2C CBL-interacting protein kinase (InterPro:IPR020660)%2C NAF domain (InterPro:IPR004041)%2C Protein kinase%2C catalytic domain (InterPro:IPR000719)%2C Calcium/calmodulin-dependent protein kinase-like (InterPro:IPR020636)%2C Tyrosine-protein kinase%2C catalytic domain (InterPro:IPR020635)%3B BEST Arabidopsis thaliana protein match is: CBL-interacting protein kinase 23 (TAIR:AT1G30270.1)%3B Has 130203 Blast hits to 128118 proteins in 4349 species: Archae - 165%3B Bacteria - 15262%3B Metazoa - 47961%3B Fungi - 13206%3B Plants - 31482%3B Viruses - 522%3B Other Eukaryotes - 21605 (source: NCBI BLink).; conf_rating=****; Dbxref=PMID:11230129, PMID:12805596, PMID:12045290, PMID:14730064, PMID:15574398, PMID:15703057, PMID:16146321, PMID:16214899, PMID:16673935, PMID:17397506, PMID:17551672, PMID:18650403, PMID:18775970, PMID:17486125, PMID:20870959, PMID:21477822, PMID:23109687, PMID:25614064, PMID:25646412, locus:2035367; locus_type=protein_coding LOCN Intron COOR C/64398-64475,64582-64656,64751-64807,64901-65017,65110-65217,65331-65456,65563-65652,65739-65864,66107-66160,66262-66342,66450-66557,66678-66749,66835-66897,67324-67512 HITS AT1G01140.2[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01140.2 CDS ID=AT1G01140.2; Parent=AT1G01140; Name=AT1G01140.2; Note=CBL-interacting protein kinase 9; curator_summary=Encodes a CBL-interacting protein kinase with similarity to SOS2; conf_class=3; symbol=CIPK9; Alias=PKS6, PROTEIN KINASE 6, SnRK3.12, SNF1-RELATED PROTEIN KINASE 3.12; full_name=CBL-interacting protein kinase 9; computational_description=CBL-interacting protein kinase 9 (CIPK9)%3B FUNCTIONS IN: protein serine/threonine kinase activity%2C protein kinase activity%2C kinase activity%2C ATP binding%3B INVOLVED IN: in 6 processes%3B EXPRESSED IN: 23 plant structures%3B EXPRESSED DURING: 15 growth stages%3B CONTAINS InterPro DOMAIN/s: Protein kinase%2C ATP binding site (InterPro:IPR017441)%2C NAF/FISL domain (InterPro:IPR018451)%2C Serine/threonine-protein kinase domain (InterPro:IPR002290)%2C Serine/threonine-protein kinase-like domain (InterPro:IPR017442)%2C Protein kinase-like domain (InterPro:IPR011009)%2C Serine/threonine-protein kinase%2C active site (InterPro:IPR008271)%2C CBL-interacting protein kinase (InterPro:IPR020660)%2C NAF domain (InterPro:IPR004041)%2C Protein kinase%2C catalytic domain (InterPro:IPR000719)%2C Calcium/calmodulin-dependent protein kinase-like (InterPro:IPR020636)%2C Tyrosine-protein kinase%2C catalytic domain (InterPro:IPR020635)%3B BEST Arabidopsis thaliana protein match is: CBL-interacting protein kinase 23 (TAIR:AT1G30270.1)%3B Has 130203 Blast hits to 128118 proteins in 4349 species: Archae - 165%3B Bacteria - 15262%3B Metazoa - 47961%3B Fungi - 13206%3B Plants - 31482%3B Viruses - 522%3B Other Eukaryotes - 21605 (source: NCBI BLink).; conf_rating=****; Dbxref=PMID:11230129, PMID:12805596, PMID:12045290, PMID:14730064, PMID:15574398, PMID:15703057, PMID:16146321, PMID:16214899, PMID:16673935, PMID:17397506, PMID:17551672, PMID:18650403, PMID:18775970, PMID:17486125, PMID:20870959, PMID:21477822, PMID:23109687, PMID:25614064, PMID:25646412, locus:2035367; locus_type=protein_coding LOCN Intron COOR C/64398-64475,64582-64656,64751-64807,64901-65017,65110-65217,65331-65456,65563-65652,65733-65864,66107-66160,66262-66342,66450-66557,66678-66749,66835-66897,67324-67512 HITS AT1G01140.3[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01140.3 CDS ID=AT1G01140.3; Parent=AT1G01140; Name=AT1G01140.3; Note=CBL-interacting protein kinase 9; curator_summary=Encodes a CBL-interacting protein kinase with similarity to SOS2; conf_class=2; symbol=CIPK9; Alias=PKS6, PROTEIN KINASE 6, SnRK3.12, SNF1-RELATED PROTEIN KINASE 3.12; full_name=CBL-interacting protein kinase 9; computational_description=CBL-interacting protein kinase 9 (CIPK9)%3B FUNCTIONS IN: protein serine/threonine kinase activity%2C protein kinase activity%2C kinase activity%2C ATP binding%3B INVOLVED IN: in 6 processes%3B EXPRESSED IN: 23 plant structures%3B EXPRESSED DURING: 15 growth stages%3B CONTAINS InterPro DOMAIN/s: Protein kinase%2C ATP binding site (InterPro:IPR017441)%2C NAF/FISL domain (InterPro:IPR018451)%2C Serine/threonine-protein kinase domain (InterPro:IPR002290)%2C Serine/threonine-protein kinase-like domain (InterPro:IPR017442)%2C Protein kinase-like domain (InterPro:IPR011009)%2C Serine/threonine-protein kinase%2C active site (InterPro:IPR008271)%2C CBL-interacting protein kinase (InterPro:IPR020660)%2C NAF domain (InterPro:IPR004041)%2C Protein kinase%2C catalytic domain (InterPro:IPR000719)%2C Calcium/calmodulin-dependent protein kinase-like (InterPro:IPR020636)%2C Tyrosine-protein kinase%2C catalytic domain (InterPro:IPR020635)%3B BEST Arabidopsis thaliana protein match is: CBL-interacting protein kinase 23 (TAIR:AT1G30270.1)%3B Has 130203 Blast hits to 128118 proteins in 4349 species: Archae - 165%3B Bacteria - 15262%3B Metazoa - 47961%3B Fungi - 13206%3B Plants - 31482%3B Viruses - 522%3B Other Eukaryotes - 21605 (source: NCBI BLink).; conf_rating=****; Dbxref=PMID:11230129, PMID:12805596, PMID:12045290, PMID:14730064, PMID:15574398, PMID:15703057, PMID:16146321, PMID:16214899, PMID:16673935, PMID:17397506, PMID:17551672, PMID:18650403, PMID:18775970, PMID:17486125, PMID:20870959, PMID:21477822, PMID:23109687, PMID:25614064, PMID:25646412, locus:2035367; locus_type=protein_coding LOCN Intron COOR C/64398-64475,64570-64656,64751-64807,64901-65017,65110-65217,65331-65456,65563-65652,65739-65864,66107-66160,66262-66342,66450-66557,66678-66749,66835-66897,67324-67512