CLON SALKseq_109467.1  T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG CHRO chr2 EVAL 0 COOR C/16979683-16979683 NOTE KG789803 Salk 20K 2:16979632 TTTTTTATGAAAATTCGGTTTAGAATCTATGAAAATCTAGATTTGCGAATTGCCGCTTAGGTGTAAACAAATTGACGCT HITS AT2G40700.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT2G40700.1 CDS ID=AT2G40700.1; Parent=AT2G40700; Name=AT2G40700.1; Note=P-loop containing nucleoside triphosphate hydrolases superfamily protein; conf_class=2; computational_description=P-loop containing nucleoside triphosphate hydrolases superfamily protein%3B FUNCTIONS IN: helicase activity%2C ATP binding%2C ATP-dependent helicase activity%2C nucleic acid binding%3B EXPRESSED IN: 23 plant structures%3B EXPRESSED DURING: 13 growth stages%3B CONTAINS InterPro DOMAIN/s: RNA helicase%2C DEAD-box type%2C Q motif (InterPro:IPR014014)%2C DNA/RNA helicase%2C DEAD/DEAH box type%2C N-terminal (InterPro:IPR011545)%2C DEAD-like helicase%2C N-terminal (InterPro:IPR014001)%2C DNA/RNA helicase%2C C-terminal (InterPro:IPR001650)%2C Helicase%2C superfamily 1/2%2C ATP-binding domain (InterPro:IPR014021)%3B BEST Arabidopsis thaliana protein match is: DEA(D/H)-box RNA helicase family protein (TAIR:AT5G65900.1)%3B Has 40440 Blast hits to 37904 proteins in 2977 species: Archae - 739%3B Bacteria - 19708%3B Metazoa - 6217%3B Fungi - 4486%3B Plants - 2481%3B Viruses - 5%3B Other Eukaryotes - 6804 (source: NCBI BLink).; conf_rating=****; Dbxref=PMID:15356332, PMID:20687615, locus:2064844; locus_type=protein_coding LOCN 300-UTR3 COOR W/16976780-16976918,16977008-16977080,16977182-16977291,16977376-16977519,16977581-16977689,16977772-16978124,16978200-16978273,16978367-16978674,16978774-16979020,16979117-16979392 HITS AT2G09160.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT2G09160.1 lnc_RNA ID=AT2G09160.1; Parent=AT2G09160; Name=AT2G09160.1; locus_type=long_noncoding_rna LOCN 1000-Promotor COOR W/16980436-16980783