CLON SALKseq_106238.0  T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG CHRO chr1 EVAL 0 COOR C/18415339-18415339 NOTE KG788131 Salk 100K 1:18415316 TAAAGTTTTATTGTTACTAATAAAAAATAACAGTCACAGCTTCTACAACTTTGTTTTACCAATCTGATTTTAACAAATTGACGCTTAGACAACTTAATAA HITS AT1TE61035[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1TE61035 transposable_element ID=AT1TE61035; Name=AT1TE61035; Alias=ATREP11 LOCN 300-UTR5 COOR C/18414725-18415296 HITS AT1TE61040[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1TE61040 transposable_element ID=AT1TE61040; Name=AT1TE61040; Alias=HELITRON2 LOCN 300-UTR3 COOR W/18415297-18415336