CLON SALKseq_103920.3  T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG CHRO chr1 EVAL 0 COOR C/57362-57362 NOTE KO436312 Salk 20K 1:57363 ATTTTCAATCGACAACTTACATCAACAATTAAAAAATAAAATCAAGAAGAACACAACCAAATTGACGCTTAGACAACTT HITS AT1G01120.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01120.1 CDS ID=AT1G01120.1; Parent=AT1G01120; Name=AT1G01120.1; Note=3-ketoacyl-CoA synthase 1; curator_summary=Encodes a condensing enzyme KCS1 (3-ketoacyl-CoA synthase 1) which is involved in the critical fatty acid elongation process in wax biosynthesis.; conf_class=1; symbol=KCS1; full_name=3-ketoacyl-CoA synthase 1; computational_description=3-ketoacyl-CoA synthase 1 (KCS1)%3B FUNCTIONS IN: fatty acid elongase activity%2C acyltransferase activity%3B INVOLVED IN: in 7 processes%3B LOCATED IN: cytosolic ribosome%2C endoplasmic reticulum%2C membrane%3B EXPRESSED IN: 29 plant structures%3B EXPRESSED DURING: 13 growth stages%3B CONTAINS InterPro DOMAIN/s: Thiolase-like (InterPro:IPR016039)%2C Very-long-chain 3-ketoacyl-CoA synthase (InterPro:IPR012392)%2C 3-Oxoacyl-[acyl-carrier-protein (ACP)] synthase III C-terminal (InterPro:IPR013747)%2C FAE1/Type III polyketide synthase-like protein (InterPro:IPR013601)%2C Thiolase-like%2C subgroup (InterPro:IPR016038)%3B BEST Arabidopsis thaliana protein match is: 3-ketoacyl-CoA synthase 11 (TAIR:AT2G26640.1)%3B Has 3961 Blast hits to 3946 proteins in 966 species: Archae - 0%3B Bacteria - 1388%3B Metazoa - 0%3B Fungi - 5%3B Plants - 2408%3B Viruses - 0%3B Other Eukaryotes - 160 (source: NCBI BLink).; conf_rating=*****; Dbxref=PMID:10074711, PMID:11341960, PMID:12753585, PMID:15070782, PMID:18465198, PMID:18650403, PMID:20736450, PMID:22284369, PMID:23505340, locus:2200955; locus_type=protein_coding LOCN 300-UTR3 COOR C/57392-58978