CLON SALKseq_090259.0  T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG CHRO chr1 EVAL 0 COOR C/49678-49678 NOTE KO429051 Salk 80K 1:49619 TTCTTTAAGATTTGTATATAATCCCATAAATCTTTTGTTATCAGGTAGAGCTATAGATGCAAATTGACGCTTAGACAA HITS AT1G01090.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [NCBI] [KEGG] [Protein Interaction] [AtGene Express] [AtGDB View]
[e-FP Browser] [AthaMap] [Phosphat] [Methylome] [UToronto BAR Expression Angler] [Araport ] [TAIR ]
Genome Browsers: [1001 Genomes] [1001 Epigenomes] [ABA TF Network] TYPE Gene TITL AT1G01090.1 CDS AT1G01090 ID=AT1G01090.1; Parent=AT1G01090; Name=AT1G01090.1; Note=pyruvate dehydrogenase E1 alpha; curator_summary=pyruvate dehydrogenase E1 alpha subunit; conf_class=2; symbol=PDH-E1 ALPHA; full_name=pyruvate dehydrogenase E1 alpha; computational_description=pyruvate dehydrogenase E1 alpha (PDH-E1 ALPHA)%3B FUNCTIONS IN: pyruvate dehydrogenase (acetyl-transferring) activity%3B INVOLVED IN: oxidation reduction%2C glycolysis%2C metabolic process%3B LOCATED IN: chloroplast%2C plastid%2C chloroplast envelope%3B EXPRESSED IN: 25 plant structures%3B EXPRESSED DURING: 15 growth stages%3B CONTAINS InterPro DOMAIN/s: Dehydrogenase%2C E1 component (InterPro:IPR001017)%2C Pyruvate dehydrogenase (acetyl-transferring) E1 component%2C alpha subunit%2C subgroup y (InterPro:IPR017597)%3B BEST Arabidopsis thaliana protein match is: pyruvate dehydrogenase complex E1 alpha subunit (TAIR:AT1G59900.1)%3B Has 10065 Blast hits to 10059 proteins in 1888 species: Archae - 130%3B Bacteria - 6136%3B Metazoa - 517%3B Fungi - 241%3B Plants - 224%3B Viruses - 0%3B Other Eukaryotes - 2817 (source: NCBI BLink).; conf_rating=****; Dbxref=PMID:9393637, PMID:12084821, PMID:12805597, PMID:13677473, PMID:14576160, PMID:14682612, PMID:15052571, PMID:15173569, PMID:15561727, PMID:15703057, PMID:16553896, PMID:17419836, PMID:18650403, PMID:18616834, PMID:18689444, PMID:18775970, PMID:23505340, PMID:24023856, locus:2200980; locus_type=protein_coding LOCN 1000-Promotor COOR C/47705-47982,48075-48852,48936-49166