CLON SALKseq_085489.2  T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG CHRO chr1 EVAL 0 COOR C/86488-86488 NOTE KO428179 Salk 70K 1:86489 TTGATAAAACTCTAGTTTTTACTTAACATTTTGATTGAATAGTGGTGTAATCATGTTCAGGATACATTGTGGTGTAAAC HITS AT1G01200.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [NCBI] [KEGG] [Protein Interaction] [AtGene Express] [AtGDB View]
[e-FP Browser] [AthaMap] [Phosphat] [Methylome] [UToronto BAR Expression Angler] [Araport ] [TAIR ]
Genome Browsers: [1001 Genomes] [1001 Epigenomes] [ABA TF Network] TYPE Gene TITL AT1G01200.1 CDS AT1G01200 ID=AT1G01200.1; Parent=AT1G01200; Name=AT1G01200.1; Note=RAB GTPase homolog A3; conf_class=1; symbol=RABA3; Alias=ATRAB-A3, ARABIDOPSIS RAB GTPASE HOMOLOG A3, ATRABA3, RAB GTPase homolog A3; full_name=RAB GTPase homolog A3; computational_description=RAB GTPase homolog A3 (RABA3)%3B FUNCTIONS IN: GTP binding%3B INVOLVED IN: protein transport%2C small GTPase mediated signal transduction%3B LOCATED IN: endosome%2C nucleus%2C cell plate%3B EXPRESSED IN: lateral root cap%2C hypocotyl%2C root%2C flower%2C epidermis%3B EXPRESSED DURING: petal differentiation and expansion stage%3B CONTAINS InterPro DOMAIN/s: Ras GTPase (InterPro:IPR001806)%2C Small GTP-binding protein (InterPro:IPR005225)%2C Small GTPase (InterPro:IPR020851)%2C Ras (InterPro:IPR013753)%2C Ras small GTPase%2C Rab type (InterPro:IPR003579)%2C Rab11-related (InterPro:IPR015595)%3B BEST Arabidopsis thaliana protein match is: RAB GTPase homolog A4C (TAIR:AT5G47960.1)%3B Has 27164 Blast hits to 27137 proteins in 734 species: Archae - 19%3B Bacteria - 134%3B Metazoa - 14292%3B Fungi - 3779%3B Plants - 3194%3B Viruses - 20%3B Other Eukaryotes - 5726 (source: NCBI BLink).; conf_rating=*****; Dbxref=PMID:12644670, PMID:15703057, PMID:16581873, PMID:18239134, locus:2035302; locus_type=protein_coding LOCN 300-UTR3 COOR C/86715-87162,87880-88145