CLON SALKseq_081907.1  T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG CHRO chr1 EVAL 0 COOR C/79918-79918 NOTE KO417550 Salk 70K 1:79919 AATTATGTCTACGGATTTGTAATTATTTCAAATTCATAAACAAAAATTTTAAATTTAATAGGATGGATTGATGACATT HITS AT1G08765.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G08765.1 transcript_region ID=AT1G08765.1; Parent=AT1G08765; computational_description=novel transcribed region; Name=AT1G08765.1; locus_type=novel_transcribed_region LOCN Exon COOR W/77537-80345 HITS AT1G01183.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01183.1 miRNA_primary_transcript ID=AT1G01183.1; Parent=AT1G01183; Alias=p_MI0000199; Name=ath-MIR165a; symbol=MIR165A; curator_summary=Encodes a microRNA that targets several HD-ZIPIII family members including PHV%2C PHB%2C REV%2C ATHB-8%2C and ATHB-15. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCGGACCAGGCUUCAUCCCC; Note=microRNA ath-MIR165a precursor; full_name=microRNA165A; Dbxref=PMID:15200956, PMID:18794352, PMID:19054365, PMID:17549070, PMID:19704656, PMID:19879265, PMID:20410882, PMID:21483759, PMID:21558378, PMID:21610018, PMID:22476466, PMID:22589131, PMID:22951404, PMID:23292599, PMID:23645346, PMID:23918970, PMID:23935517, PMID:24296072, locus:1009023078, PMID:15200956, PMID:18794352, PMID:19054365, PMID:17549070, PMID:19704656, PMID:19879265, PMID:20410882, PMID:21483759, PMID:21558378, PMID:21610018, PMID:22476466, PMID:22589131, PMID:22951404, PMID:23292599, PMID:23645346, PMID:23918970, PMID:23935517, PMID:24296072, PMID:25406978, PMID:25711809, locus:1009023078; locus_type=mirna LOCN 1000-Promotor COOR C/78927-79037 HITS ath-miR165a-3p[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL ath-miR165a-3p miRNA ID=ath-miR165a-3p; Alias=MIMAT0000187; Name=ath-miR165a-3p; Derives_from=AT1G01183.1; Note=microRNA ath-miR165a-3p; computational_description=mature miRNA accession:MIMAT0000187 LOCN 1000-Promotor COOR C/78932-78952 HITS ath-miR165a-5p[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL ath-miR165a-5p miRNA ID=ath-miR165a-5p; Alias=MIMAT0031879; Name=ath-miR165a-5p; Derives_from=AT1G01183.1; Note=microRNA ath-miR165a-5p; computational_description=mature miRNA accession:MIMAT0031879 LOCN 1000-Promotor COOR C/79010-79030