CLON SALKseq_081595.0  T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG CHRO chr1 EVAL 0 COOR C/24388-24388 NOTE KO437366 Salk 70K 1:24324 AAAGACACTTATCGCGACTCTTCTTATTAAAAGTGTTCATAAGGATCTGGGGTGGTTTTGGTGTAAACAAATTGACGCT HITS AT1G03993.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G03993.1 antisense_lncRNA ID=AT1G03993.1; Parent=AT1G03993; Name=AT1G03993.1; description=Natural antisense transcript overlaps with AT1G01040; Note=Natural antisense transcript overlaps with AT1G01040; locus_type=antisense_long_noncoding_rna LOCN 300-UTR5 COOR C/23312-24099 HITS AT1G01040.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01040.1 CDS ID=AT1G01040.1; Parent=AT1G01040; Name=AT1G01040.1; Note=dicer-like 1; curator_summary=Encodes a Dicer homolog. Dicer is a RNA helicase involved in microRNA processing. Mutations in this locus can result in embryo lethality. Embryo shape at seed maturity is globular-elongate. Other mutants convert the floral meristems to an indeterminate state%2C others yet show defects in ovule development. mRNA is expressed in all shoot tissues. DCL1 is able to produce miRNAs and siRNAs.; conf_class=2; symbol=DCL1; Alias=ASU1, ABNORMAL SUSPENSOR 1, ATDCL1, DICER-LIKE 1, CAF, CARPEL FACTORY, EMB60, EMBRYO DEFECTIVE 60, EMB76, EMBRYO DEFECTIVE 76, SIN1, SHORT INTEGUMENTS 1, SUS1, SUSPENSOR 1; full_name=dicer-like 1; computational_description=dicer-like 1 (DCL1)%3B CONTAINS InterPro DOMAIN/s: Restriction endonuclease%2C type I%2C R subunit/Type III%2C Res subunit (InterPro:IPR006935)%2C Double-stranded RNA-binding (InterPro:IPR001159)%2C Argonaute/Dicer protein%2C PAZ (InterPro:IPR003100)%2C Ribonuclease III (InterPro:IPR000999)%2C Double-stranded RNA-binding-like (InterPro:IPR014720)%2C DEAD-like helicase%2C N-terminal (InterPro:IPR014001)%2C DNA/RNA helicase%2C C-terminal (InterPro:IPR001650)%2C Helicase%2C superfamily 1/2%2C ATP-binding domain (InterPro:IPR014021)%2C Dicer double-stranded RNA-binding fold (InterPro:IPR005034)%3B BEST Arabidopsis thaliana protein match is: dicer-like 3 (TAIR:AT3G43920.2)%3B Has 21958 Blast hits to 17420 proteins in 2982 species: Archae - 328%3B Bacteria - 11461%3B Metazoa - 3615%3B Fungi - 1668%3B Plants - 1373%3B Viruses - 45%3B Other Eukaryotes - 3468 (source: NCBI BLink).; conf_rating=****; Dbxref=PMID:10556049, PMID:8948599, PMID:8787738, PMID:7982564, PMID:12101121, PMID:12324593, PMID:12297633, PMID:12225663, PMID:12417148, PMID:12376646, PMID:12573220, PMID:12747833, PMID:12725739, PMID:12857820, PMID:14972688, PMID:15024409, PMID:15314213, PMID:15469823, PMID:15851028, PMID:16033795, PMID:16111943, PMID:16096641, PMID:16040244, PMID:16141062, PMID:16144699, PMID:15821876, PMID:16214897, PMID:16428603, PMID:16500993, PMID:16699516, PMID:16682354, PMID:16810317, PMID:16889646, PMID:17090584, PMID:17182867, PMID:17164336, PMID:17337628, PMID:17369351, PMID:17442570, PMID:17558406, PMID:17675322, PMID:18003861, PMID:18208512, PMID:18550839, PMID:18650403, PMID:18632581, PMID:18632569, PMID:18625233, PMID:18799732, PMID:18842626, PMID:18997003, PMID:19221817, PMID:17071740, PMID:18551175, PMID:19155326, PMID:19307293, PMID:19436261, PMID:19816405, PMID:20106953, PMID:20409179, PMID:20462493, PMID:20439431, PMID:20621980, PMID:20870966, PMID:19649244, PMID:19953107, PMID:21123653, PMID:21330492, PMID:21295131, PMID:21378120, PMID:21589905, PMID:21685453, PMID:22439910, PMID:22474216, PMID:22589469, PMID:22802657, PMID:22902697, PMID:22846193, PMID:23110057, PMID:23268445, PMID:23313986, PMID:23424246, PMID:23399598, PMID:23457227, PMID:23194006, PMID:23886622, PMID:23847640, PMID:23941160, PMID:23934148, PMID:23921632, PMID:24018204, PMID:24092744, PMID:24137006, PMID:24204292, PMID:24531234, PMID:24670663, PMID:24769482, PMID:24731939, PMID:24717238, PMID:24784759, PMID:25226037, PMID:25409478, PMID:25491479, PMID:25474114, PMID:25443390, PMID:23104109, locus:2200960; locus_type=protein_coding LOCN Exon COOR W/23519-24451,24542-24655,24752-24962,25041-25435,25524-25743,25825-25997,26081-26203,26292-26452,26543-26776,26862-27012,27099-27281,27372-27533,27618-27713,27803-28431,28708-28805,28890-29080,29160-30065,30147-30311,30410-30816,30902-31079 HITS AT1G01040.2[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01040.2 CDS ID=AT1G01040.2; Parent=AT1G01040; Name=AT1G01040.2; Note=dicer-like 1; curator_summary=Encodes a Dicer homolog. Dicer is a RNA helicase involved in microRNA processing. Mutations in this locus can result in embryo lethality. Embryo shape at seed maturity is globular-elongate. Other mutants convert the floral meristems to an indeterminate state%2C others yet show defects in ovule development. mRNA is expressed in all shoot tissues. DCL1 is able to produce miRNAs and siRNAs.; conf_class=2; symbol=DCL1; Alias=ASU1, ABNORMAL SUSPENSOR 1, ATDCL1, DICER-LIKE 1, CAF, CARPEL FACTORY, EMB60, EMBRYO DEFECTIVE 60, EMB76, EMBRYO DEFECTIVE 76, SIN1, SHORT INTEGUMENTS 1, SUS1, SUSPENSOR 1; full_name=dicer-like 1; computational_description=dicer-like 1 (DCL1)%3B CONTAINS InterPro DOMAIN/s: Restriction endonuclease%2C type I%2C R subunit/Type III%2C Res subunit (InterPro:IPR006935)%2C Double-stranded RNA-binding (InterPro:IPR001159)%2C Argonaute/Dicer protein%2C PAZ (InterPro:IPR003100)%2C Ribonuclease III (InterPro:IPR000999)%2C Double-stranded RNA-binding-like (InterPro:IPR014720)%2C DEAD-like helicase%2C N-terminal (InterPro:IPR014001)%2C DNA/RNA helicase%2C C-terminal (InterPro:IPR001650)%2C Helicase%2C superfamily 1/2%2C ATP-binding domain (InterPro:IPR014021)%2C Dicer double-stranded RNA-binding fold (InterPro:IPR005034)%3B BEST Arabidopsis thaliana protein match is: dicer-like 3 (TAIR:AT3G43920.2)%3B Has 21958 Blast hits to 17420 proteins in 2982 species: Archae - 328%3B Bacteria - 11461%3B Metazoa - 3615%3B Fungi - 1668%3B Plants - 1373%3B Viruses - 45%3B Other Eukaryotes - 3468 (source: NCBI BLink).; conf_rating=****; Dbxref=PMID:10556049, PMID:8948599, PMID:8787738, PMID:7982564, PMID:12101121, PMID:12324593, PMID:12297633, PMID:12225663, PMID:12417148, PMID:12376646, PMID:12573220, PMID:12747833, PMID:12725739, PMID:12857820, PMID:14972688, PMID:15024409, PMID:15314213, PMID:15469823, PMID:15851028, PMID:16033795, PMID:16111943, PMID:16096641, PMID:16040244, PMID:16141062, PMID:16144699, PMID:15821876, PMID:16214897, PMID:16428603, PMID:16500993, PMID:16699516, PMID:16682354, PMID:16810317, PMID:16889646, PMID:17090584, PMID:17182867, PMID:17164336, PMID:17337628, PMID:17369351, PMID:17442570, PMID:17558406, PMID:17675322, PMID:18003861, PMID:18208512, PMID:18550839, PMID:18650403, PMID:18632581, PMID:18632569, PMID:18625233, PMID:18799732, PMID:18842626, PMID:18997003, PMID:19221817, PMID:17071740, PMID:18551175, PMID:19155326, PMID:19307293, PMID:19436261, PMID:19816405, PMID:20106953, PMID:20409179, PMID:20462493, PMID:20439431, PMID:20621980, PMID:20870966, PMID:19649244, PMID:19953107, PMID:21123653, PMID:21330492, PMID:21295131, PMID:21378120, PMID:21589905, PMID:21685453, PMID:22439910, PMID:22474216, PMID:22589469, PMID:22802657, PMID:22902697, PMID:22846193, PMID:23110057, PMID:23268445, PMID:23313986, PMID:23424246, PMID:23399598, PMID:23457227, PMID:23194006, PMID:23886622, PMID:23847640, PMID:23941160, PMID:23934148, PMID:23921632, PMID:24018204, PMID:24092744, PMID:24137006, PMID:24204292, PMID:24531234, PMID:24670663, PMID:24769482, PMID:24731939, PMID:24717238, PMID:24784759, PMID:25226037, PMID:25409478, PMID:25491479, PMID:25474114, PMID:25443390, PMID:23104109, locus:2200960; locus_type=protein_coding LOCN Exon COOR W/23519-24451,24542-24655,24752-24962,25041-25435,25524-25743,25825-25997,26081-26203,26292-26452,26543-26776,26862-27012,27099-27281,27372-27536,27618-27713,27803-28431,28708-28805,28890-29080,29160-30065,30147-30311,30410-30816,30902-31079