CLON SALKseq_079075.1  T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG CHRO chr2 EVAL 0 COOR W/16980613-16980613 NOTE KO433658 Salk 70K 2:16980617 TGAAAACGCAGAAAATTCATAAAATTCATAAGTGTTTATTATTGTTTTCAATATATGACAGGATATATTGTGGTGTAAA HITS AT2G09160.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT2G09160.1 lnc_RNA ID=AT2G09160.1; Parent=AT2G09160; Name=AT2G09160.1; locus_type=long_noncoding_rna LOCN Exon COOR W/16980436-16980783