CLON SALKseq_076364.0  T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG CHRO chr2 EVAL 0 COOR C/17009966-17009966 NOTE KO400030 Salk 70K 2:17009968 AAATTTGAAAACTGAAAACCTTTTAAAACGAAAAAGAATGGCTAAGATGATGAATGGCTAATATATTGTGGTGTAAAC HITS AT2TE76595[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT2TE76595 transposable_element ID=AT2TE76595; Name=AT2TE76595; Alias=ATREP10D LOCN 300-UTR5 COOR C/17008780-17009940 HITS AT2G40760.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT2G40760.1 CDS ID=AT2G40760.1; Parent=AT2G40760; Name=AT2G40760.1; Note=Rhodanese/Cell cycle control phosphatase superfamily protein; conf_class=2; computational_description=Rhodanese/Cell cycle control phosphatase superfamily protein%3B CONTAINS InterPro DOMAIN/s: Rhodanese-like (InterPro:IPR001763)%3B BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G09280.1)%3B Has 5729 Blast hits to 5726 proteins in 1464 species: Archae - 2%3B Bacteria - 2945%3B Metazoa - 57%3B Fungi - 3%3B Plants - 114%3B Viruses - 0%3B Other Eukaryotes - 2608 (source: NCBI BLink).; conf_rating=****; Dbxref=PMID:12492831, PMID:12482606, PMID:12535341, PMID:14576160, PMID:15937229, PMID:16212609, PMID:17408957, locus:2064796; locus_type=protein_coding LOCN 300-UTR5 COOR W/17010050-17010445,17010606-17010857,17010941-17011039,17011214-17011510,17011588-17011968