CLON SALKseq_071710.0  T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG CHRO chr1 EVAL 0 COOR C/74216-74216 NOTE KO356396 Salk 50K 1:74141 CATGCTTGGAATTTCTCATCCGTTGCTGCCCACTCCAGGATATATATATTGCGGACAAATATATTGTGGTGTAAACAA HITS AT1G01170.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01170.1 CDS ID=AT1G01170.1; Parent=AT1G01170; Name=AT1G01170.1; Note=ozone-responsive stress-like protein (DUF1138); conf_class=2; computational_description=Protein of unknown function (DUF1138)%3B FUNCTIONS IN: molecular_function unknown%3B INVOLVED IN: response to stress%3B LOCATED IN: mitochondrion%2C membrane%3B EXPRESSED IN: 23 plant structures%3B EXPRESSED DURING: 13 growth stages%3B CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1138 (InterPro:IPR009515)%3B BEST Arabidopsis thaliana protein match is: Protein of unknown function (DUF1138) (TAIR:AT4G00860.1)%3B Has 86 Blast hits to 86 proteins in 15 species: Archae - 0%3B Bacteria - 0%3B Metazoa - 0%3B Fungi - 0%3B Plants - 86%3B Viruses - 0%3B Other Eukaryotes - 0 (source: NCBI BLink).; conf_rating=****; Dbxref=PMID:15703057, PMID:16055634, PMID:17059406, PMID:17432890, locus:2035247; locus_type=protein_coding LOCN Exon COOR C/74105-74250,74338-74443 HITS AT1G01170.2[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01170.2 CDS ID=AT1G01170.2; Parent=AT1G01170; Name=AT1G01170.2; Note=ozone-responsive stress-like protein (DUF1138); conf_class=2; computational_description=Protein of unknown function (DUF1138)%3B FUNCTIONS IN: molecular_function unknown%3B INVOLVED IN: response to stress%3B LOCATED IN: mitochondrion%2C membrane%3B EXPRESSED IN: 23 plant structures%3B EXPRESSED DURING: 13 growth stages%3B CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1138 (InterPro:IPR009515)%3B BEST Arabidopsis thaliana protein match is: Protein of unknown function (DUF1138) (TAIR:AT4G00860.1)%3B Has 86 Blast hits to 86 proteins in 15 species: Archae - 0%3B Bacteria - 0%3B Metazoa - 0%3B Fungi - 0%3B Plants - 86%3B Viruses - 0%3B Other Eukaryotes - 0 (source: NCBI BLink).; conf_rating=****; Dbxref=PMID:15703057, PMID:16055634, PMID:17059406, PMID:17432890, locus:2035247; locus_type=protein_coding LOCN Exon COOR C/74105-74250,74338-74443 HITS AT1G04013.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G04013.1 antisense_lncRNA ID=AT1G04013.1; Parent=AT1G04013; Name=AT1G04013.1; description=Natural antisense transcript overlaps with AT1G01170; Note=Natural antisense transcript overlaps with AT1G01170; locus_type=antisense_long_noncoding_rna LOCN 300-UTR5 COOR W/74435-74683