CLON SALKseq_071685.1  T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG CHRO chr1 EVAL 0 COOR W/19857286-19857286 NOTE KO393225 Salk 50K 1:19857315 CAGACACGAAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGCGGGAGAAACAGATAAGGAAGATGAAGAACACTAATG HITS AT1G53240.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G53240.1 CDS ID=AT1G53240.1; Parent=AT1G53240; Name=AT1G53240.1; Note=Lactate/malate dehydrogenase family protein; curator_summary=mMDH1 encodes a mitochrondrial malate dehydrogenase. It is expressed at higher levels than the other mitochrondrial isoform mMDH2 (At3G15020) according to transcript and proteomic analyses.; conf_class=2; symbol=mMDH1; full_name=mitochondrial malate dehydrogenase 1; computational_description=Lactate/malate dehydrogenase family protein%3B FUNCTIONS IN: malate dehydrogenase activity%2C copper ion binding%3B INVOLVED IN: response to cadmium ion%2C response to salt stress%2C response to cold%2C defense response to bacterium%2C peptidyl-cysteine S-nitrosylation%3B LOCATED IN: mitochondrion%2C cell wall%2C chloroplast%3B EXPRESSED IN: 26 plant structures%3B EXPRESSED DURING: 15 growth stages%3B CONTAINS InterPro DOMAIN/s: Lactate/malate dehydrogenase%2C C-terminal (InterPro:IPR022383)%2C Malate dehydrogenase%2C NAD-dependent%2C eukaryote/gamma proteobacteria (InterPro:IPR010097)%2C NAD(P)-binding domain (InterPro:IPR016040)%2C L-lactate/malate dehydrogenase (InterPro:IPR001557)%2C Lactate/malate dehydrogenase%2C N-terminal (InterPro:IPR001236)%2C Malate dehydrogenase%2C active site (InterPro:IPR001252)%2C Lactate dehydrogenase/glycoside hydrolase%2C family 4%2C C-terminal (InterPro:IPR015955)%3B BEST Arabidopsis thaliana protein match is: Lactate/malate dehydrogenase family protein (TAIR:AT3G15020.1)%3B Has 17502 Blast hits to 17499 proteins in 5422 species: Archae - 240%3B Bacteria - 12205%3B Metazoa - 1281%3B Fungi - 536%3B Plants - 649%3B Viruses - 0%3B Other Eukaryotes - 2591 (source: NCBI BLink).; conf_rating=****; Dbxref=PMID:9774405, PMID:11743115, PMID:11743114, PMID:12492832, PMID:12777046, PMID:14500793, PMID:14535880, PMID:14671022, PMID:14730065, PMID:15052571, PMID:15276449, PMID:15769804, PMID:15971193, PMID:15998247, PMID:15923328, PMID:16199612, PMID:16254930, PMID:16377752, PMID:16502469, PMID:16679420, PMID:17028151, PMID:17163439, PMID:17376161, PMID:17828791, PMID:18223148, PMID:18297659, PMID:18650403, PMID:18811951, PMID:20018591, PMID:20118269, PMID:20876337, PMID:21798377, PMID:24296071, PMID:25277243, locus:2009605; locus_type=protein_coding LOCN 1000-Promotor COOR C/19854966-19855103,19855195-19855312,19855408-19855529,19855637-19855698,19855833-19856001,19856249-19856422,19856560-19856802 HITS AT1TE65640[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1TE65640 transposable_element ID=AT1TE65640; Name=AT1TE65640; Alias=LIMPET1 LOCN Exon COOR C/19857263-19857632 HITS AT1G53250.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G53250.1 CDS ID=AT1G53250.1; Parent=AT1G53250; Name=AT1G53250.1; Note=histone-lysine N-methyltransferase%2C H3 lysine-79 specific-like protein; conf_class=2; computational_description=unknown protein%3B BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G53800.1)%3B Has 11909 Blast hits to 7704 proteins in 757 species: Archae - 51%3B Bacteria - 1338%3B Metazoa - 4550%3B Fungi - 987%3B Plants - 464%3B Viruses - 24%3B Other Eukaryotes - 4495 (source: NCBI BLink).; conf_rating=****; Dbxref=locus:2009615; locus_type=protein_coding LOCN 300-UTR5 COOR W/19857468-19857481,19857675-19858042,19858125-19858177,19858311-19858348,19858428-19858845,19858932-19859156