CLON SALKseq_070182.5  T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG CHRO chr2 EVAL 0 COOR C/16998029-16998029 NOTE KO399823 Salk 50K 2:16998030 TGATAAATATTATGAATGATAACATAATCAAATTAGAACATAAAAATGTGGTAAATATATTTGTGGTGTAAACAAATT HITS AT2G40740.3[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT2G40740.3 CDS ID=AT2G40740.3; Parent=AT2G40740; Name=AT2G40740.3; Note=WRKY DNA-binding protein 55; symbol=WRKY55; Alias=ATWRKY55, WRKY DNA-BINDING PROTEIN 55; full_name=WRKY DNA-binding protein 55; curator_summary=member of WRKY Transcription Factor%3B Group III; computational_description=WRKY DNA-binding protein 55 (WRKY55)%3B CONTAINS InterPro DOMAIN/s: DNA-binding WRKY (InterPro:IPR003657)%3B BEST Arabidopsis thaliana protein match is: WRKY DNA-binding protein 46 (TAIR:AT2G46400.1)%3B Has 3246 Blast hits to 2806 proteins in 181 species: Archae - 0%3B Bacteria - 0%3B Metazoa - 0%3B Fungi - 0%3B Plants - 3234%3B Viruses - 0%3B Other Eukaryotes - 12 (source: NCBI BLink).; Dbxref=PMID:10785665, PMID:11118137, PMID:15282545, PMID:16913859, PMID:20179141, PMID:23818851, locus:2064816; locus_type=protein_coding LOCN Intron COOR W/16997150-16997622,16998377-16998508,16998976-16999276 HITS AT2G40740.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT2G40740.1 CDS ID=AT2G40740.1; Parent=AT2G40740; Name=AT2G40740.1; Note=WRKY DNA-binding protein 55; curator_summary=member of WRKY Transcription Factor%3B Group III; conf_class=4; symbol=WRKY55; Alias=ATWRKY55, WRKY DNA-BINDING PROTEIN 55; full_name=WRKY DNA-binding protein 55; computational_description=WRKY DNA-binding protein 55 (WRKY55)%3B CONTAINS InterPro DOMAIN/s: DNA-binding WRKY (InterPro:IPR003657)%3B BEST Arabidopsis thaliana protein match is: WRKY DNA-binding protein 46 (TAIR:AT2G46400.1)%3B Has 3246 Blast hits to 2806 proteins in 181 species: Archae - 0%3B Bacteria - 0%3B Metazoa - 0%3B Fungi - 0%3B Plants - 3234%3B Viruses - 0%3B Other Eukaryotes - 12 (source: NCBI BLink).; conf_rating=***; Dbxref=PMID:10785665, PMID:11118137, PMID:15282545, PMID:16913859, PMID:20179141, PMID:23818851, locus:2064816; locus_type=protein_coding LOCN Intron COOR W/16997177-16997622,16998377-16998508,16998976-16999276 HITS AT2G40740.2[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT2G40740.2 CDS ID=AT2G40740.2; Parent=AT2G40740; Name=AT2G40740.2; Note=WRKY DNA-binding protein 55; curator_summary=member of WRKY Transcription Factor%3B Group III; conf_class=1; symbol=WRKY55; Alias=ATWRKY55, WRKY DNA-BINDING PROTEIN 55; full_name=WRKY DNA-binding protein 55; computational_description=WRKY DNA-binding protein 55 (WRKY55)%3B CONTAINS InterPro DOMAIN/s: DNA-binding WRKY (InterPro:IPR003657)%3B BEST Arabidopsis thaliana protein match is: WRKY DNA-binding protein 46 (TAIR:AT2G46400.1)%3B Has 3246 Blast hits to 2806 proteins in 181 species: Archae - 0%3B Bacteria - 0%3B Metazoa - 0%3B Fungi - 0%3B Plants - 3234%3B Viruses - 0%3B Other Eukaryotes - 12 (source: NCBI BLink).; conf_rating=*****; Dbxref=PMID:10785665, PMID:11118137, PMID:15282545, PMID:16913859, PMID:20179141, PMID:23818851, locus:2064816; locus_type=protein_coding LOCN Intron COOR W/16997177-16997622,16998976-16999276 HITS AT2TE76540[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT2TE76540 transposable_element ID=AT2TE76540; Name=AT2TE76540; Alias=BRODYAGA1A LOCN Exon COOR W/16997625-16998030