CLON SALKseq_066022.2  T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG CHRO chr1 EVAL 0 COOR C/78809-78809 NOTE KO359405 Salk 50K 1:78810 TGCATATTTAGTTTAAATACAAATAAACGAAACAAAAAGCAAAAAGCATAGACGGATCCGTAAATCTACT HITS AT1G08765.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [NCBI] [KEGG] [Protein Interaction] [AtGene Express] [AtGDB View]
[e-FP Browser] [AthaMap] [Phosphat] [Methylome] [UToronto BAR Expression Angler] [Araport ] [TAIR ]
Genome Browsers: [1001 Genomes] [1001 Epigenomes] [ABA TF Network] TYPE Gene TITL AT1G08765.1 transcript_region AT1G08765 ID=AT1G08765.1; Parent=AT1G08765; computational_description=novel transcribed region; Name=AT1G08765.1; locus_type=novel_transcribed_region LOCN Exon COOR W/77537-80345 HITS AT1G08765.2[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [NCBI] [KEGG] [Protein Interaction] [AtGene Express] [AtGDB View]
[e-FP Browser] [AthaMap] [Phosphat] [Methylome] [UToronto BAR Expression Angler] [Araport ] [TAIR ]
Genome Browsers: [1001 Genomes] [1001 Epigenomes] [ABA TF Network] TYPE Gene TITL AT1G08765.2 transcript_region AT1G08765 ID=AT1G08765.2; Parent=AT1G08765; computational_description=novel transcribed region; Name=AT1G08765.2; locus_type=novel_transcribed_region LOCN Exon COOR W/77727-79340 HITS AT1TE00225[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [NCBI] [KEGG] [Protein Interaction] [AtGene Express] [AtGDB View]
[e-FP Browser] [AthaMap] [Phosphat] [Methylome] [UToronto BAR Expression Angler] [Araport ] [TAIR ]
Genome Browsers: [1001 Genomes] [1001 Epigenomes] [ABA TF Network] TYPE Gene TITL AT1TE00225 transposable_element AT1TE00225 ID=AT1TE00225; Name=AT1TE00225; Alias=HELITRONY1D LOCN 300-UTR5 COOR C/78288-78785 HITS AT1G01183.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [NCBI] [KEGG] [Protein Interaction] [AtGene Express] [AtGDB View]
[e-FP Browser] [AthaMap] [Phosphat] [Methylome] [UToronto BAR Expression Angler] [Araport ] [TAIR ]
Genome Browsers: [1001 Genomes] [1001 Epigenomes] [ABA TF Network] TYPE Gene TITL AT1G01183.1 miRNA_primary_transcript AT1G01183 ID=AT1G01183.1; Parent=AT1G01183; Alias=p_MI0000199; Name=ath-MIR165a; symbol=MIR165A; curator_summary=Encodes a microRNA that targets several HD-ZIPIII family members including PHV%2C PHB%2C REV%2C ATHB-8%2C and ATHB-15. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCGGACCAGGCUUCAUCCCC; Note=microRNA ath-MIR165a precursor; full_name=microRNA165A; Dbxref=PMID:15200956, PMID:18794352, PMID:19054365, PMID:17549070, PMID:19704656, PMID:19879265, PMID:20410882, PMID:21483759, PMID:21558378, PMID:21610018, PMID:22476466, PMID:22589131, PMID:22951404, PMID:23292599, PMID:23645346, PMID:23918970, PMID:23935517, PMID:24296072, locus:1009023078, PMID:15200956, PMID:18794352, PMID:19054365, PMID:17549070, PMID:19704656, PMID:19879265, PMID:20410882, PMID:21483759, PMID:21558378, PMID:21610018, PMID:22476466, PMID:22589131, PMID:22951404, PMID:23292599, PMID:23645346, PMID:23918970, PMID:23935517, PMID:24296072, PMID:25406978, PMID:25711809, locus:1009023078; locus_type=mirna LOCN 300-UTR3 COOR C/78927-79037 HITS ath-miR165a-3p[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [NCBI] [KEGG] [Protein Interaction] [AtGene Express] [AtGDB View]
[e-FP Browser] [AthaMap] [Phosphat] [Methylome] [UToronto BAR Expression Angler] [Araport ] [TAIR ]
Genome Browsers: [1001 Genomes] [1001 Epigenomes] [ABA TF Network] TYPE Gene TITL ath-miR165a-3p miRNA ath-miR165a-3p ID=ath-miR165a-3p; Alias=MIMAT0000187; Name=ath-miR165a-3p; Derives_from=AT1G01183.1; Note=microRNA ath-miR165a-3p; computational_description=mature miRNA accession:MIMAT0000187 LOCN 300-UTR3 COOR C/78932-78952 HITS ath-miR165a-5p[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [NCBI] [KEGG] [Protein Interaction] [AtGene Express] [AtGDB View]
[e-FP Browser] [AthaMap] [Phosphat] [Methylome] [UToronto BAR Expression Angler] [Araport ] [TAIR ]
Genome Browsers: [1001 Genomes] [1001 Epigenomes] [ABA TF Network] TYPE Gene TITL ath-miR165a-5p miRNA ath-miR165a-5p ID=ath-miR165a-5p; Alias=MIMAT0031879; Name=ath-miR165a-5p; Derives_from=AT1G01183.1; Note=microRNA ath-miR165a-5p; computational_description=mature miRNA accession:MIMAT0031879 LOCN 300-UTR3 COOR C/79010-79030