CLON SALKseq_065216.1  T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG CHRO chr1 EVAL 0 COOR C/18399593-18399593 NOTE KO392829 Salk 50K 1:18399593 TAAACTTCAGATGAGTTAGGATTTGATTTTTTAGAATTTTGGTTTTGAAAAAAAATTAGCCAACTAAAAATCAAACAA HITS AT1G07583.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G07583.1 lnc_RNA ID=AT1G07583.1; Parent=AT1G07583; Name=AT1G07583.1; locus_type=long_noncoding_rna LOCN 1000-Promotor COOR C/18398887-18399127