CLON SALKseq_064916.0  T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG CHRO chr1 EVAL 0 COOR C/18423259-18423259 NOTE KO409510 Salk 40K 1:18423259 AAACAAAAAAAATTGTAGTACACTTTGACAAAGTTGATTAGCTTTCTAAAACAACAAACCTTCCATTACCAAGAGTAG HITS AT1TE61065[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1TE61065 transposable_element ID=AT1TE61065; Name=AT1TE61065; Alias=ATREP10D LOCN Exon COOR W/18421504-18424352