CLON SALKseq_064273.3  T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG CHRO chr1 EVAL 0 COOR W/84738-84738 NOTE KO365989 Salk 50K 1:84737 CAACATTTTGCTTCCCTTCTCGTCGCCATTGCTATCACTTGGTTTACCATAACCATCGTATATATTGTGGTGTAAACA HITS AT1G01190.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01190.1 CDS ID=AT1G01190.1; Parent=AT1G01190; Name=AT1G01190.1; Note=cytochrome P450%2C family 78%2C subfamily A%2C polypeptide 8; curator_summary=member of CYP78A; conf_class=2; symbol=CYP78A8; full_name=cytochrome P450%2C family 78%2C subfamily A%2C polypeptide 8; computational_description=cytochrome P450%2C family 78%2C subfamily A%2C polypeptide 8 (CYP78A8)%3B FUNCTIONS IN: electron carrier activity%2C monooxygenase activity%2C iron ion binding%2C oxygen binding%2C heme binding%3B INVOLVED IN: oxidation reduction%3B LOCATED IN: endomembrane system%3B EXPRESSED IN: 6 plant structures%3B EXPRESSED DURING: LP.10 ten leaves visible%2C LP.02 two leaves visible%2C LP.12 twelve leaves visible%3B CONTAINS InterPro DOMAIN/s: Cytochrome P450 (InterPro:IPR001128)%2C Cytochrome P450%2C conserved site (InterPro:IPR017972)%2C Cytochrome P450%2C E-class%2C group I (InterPro:IPR002401)%3B BEST Arabidopsis thaliana protein match is: cytochrome P450%2C family 78%2C subfamily A%2C polypeptide 6 (TAIR:AT2G46660.1)%3B Has 32104 Blast hits to 32001 proteins in 1725 species: Archae - 48%3B Bacteria - 3617%3B Metazoa - 11430%3B Fungi - 6777%3B Plants - 9112%3B Viruses - 3%3B Other Eukaryotes - 1117 (source: NCBI BLink).; conf_rating=****; Dbxref=PMID:15280363, PMID:15546358, PMID:15703057, PMID:16520461, PMID:15604721, PMID:18650403, PMID:20736450, PMID:23610218, PMID:23733073, locus:2035282; locus_type=protein_coding LOCN Exon COOR C/83045-83671,83884-84864 HITS AT1G01190.2[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01190.2 CDS ID=AT1G01190.2; Parent=AT1G01190; Name=AT1G01190.2; Note=cytochrome P450%2C family 78%2C subfamily A%2C polypeptide 8; symbol=CYP78A8; full_name=cytochrome P450%2C family 78%2C subfamily A%2C polypeptide 8; curator_summary=member of CYP78A; computational_description=cytochrome P450%2C family 78%2C subfamily A%2C polypeptide 8 (CYP78A8)%3B FUNCTIONS IN: electron carrier activity%2C monooxygenase activity%2C iron ion binding%2C oxygen binding%2C heme binding%3B INVOLVED IN: oxidation reduction%3B LOCATED IN: endomembrane system%3B EXPRESSED IN: 6 plant structures%3B EXPRESSED DURING: LP.10 ten leaves visible%2C LP.02 two leaves visible%2C LP.12 twelve leaves visible%3B CONTAINS InterPro DOMAIN/s: Cytochrome P450 (InterPro:IPR001128)%2C Cytochrome P450%2C conserved site (InterPro:IPR017972)%2C Cytochrome P450%2C E-class%2C group I (InterPro:IPR002401)%3B BEST Arabidopsis thaliana protein match is: cytochrome P450%2C family 78%2C subfamily A%2C polypeptide 6 (TAIR:AT2G46660.1)%3B Has 32104 Blast hits to 32001 proteins in 1725 species: Archae - 48%3B Bacteria - 3617%3B Metazoa - 11430%3B Fungi - 6777%3B Plants - 9112%3B Viruses - 3%3B Other Eukaryotes - 1117 (source: NCBI BLink).; Dbxref=PMID:15280363, PMID:15546358, PMID:15703057, PMID:16520461, PMID:15604721, PMID:18650403, PMID:20736450, PMID:23610218, PMID:23733073, locus:2035282; locus_type=protein_coding LOCN Exon COOR C/83045-83671,83884-84879