CLON SALKseq_063355.0  T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG CHRO chr1 EVAL 0 COOR C/18391844-18391844 NOTE KO342508 Salk 40K 1:18391801 TTTCCTTCTTCCACACTGCCTCATGTTTTAAAGACTTGAACTTGGCGAGAACTGCATATACAAATTGACGCTTAGACA HITS AT1TE60935[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1TE60935 transposable_element ID=AT1TE60935; Name=AT1TE60935; Alias=ATREP11 LOCN 1000-Promotor COOR C/18390642-18391418 HITS AT1G49710.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G49710.1 CDS ID=AT1G49710.1; Parent=AT1G49710; Name=AT1G49710.1; Note=fucosyltransferase 12; curator_summary=Encodes a protein with core %26alpha%3B1%2C3-fucosyltransferase activity.; conf_class=2; symbol=FUT12; Alias=ATFUT12, FUCT2, FUCTB; full_name=fucosyltransferase 12; computational_description=fucosyltransferase 12 (FUT12)%3B FUNCTIONS IN: transferase activity%2C transferring glycosyl groups%2C fucosyltransferase activity%3B INVOLVED IN: protein amino acid glycosylation%3B LOCATED IN: Golgi apparatus%3B EXPRESSED IN: 23 plant structures%3B EXPRESSED DURING: 13 growth stages%3B CONTAINS InterPro DOMAIN/s: Glycosyl transferase%2C family 10 (InterPro:IPR001503)%3B BEST Arabidopsis thaliana protein match is: fucosyltransferase 11 (TAIR:AT3G19280.1)%3B Has 1527 Blast hits to 1523 proteins in 197 species: Archae - 4%3B Bacteria - 161%3B Metazoa - 1008%3B Fungi - 0%3B Plants - 130%3B Viruses - 3%3B Other Eukaryotes - 221 (source: NCBI BLink).; conf_rating=****; Dbxref=PMID:11743104, PMID:11420147, PMID:15013764, PMID:15295017, PMID:16618929, PMID:17085506, PMID:17630273, PMID:18650403, PMID:21478158, locus:2012217; locus_type=protein_coding LOCN Exon COOR C/18391622-18391877,18391966-18392196,18392281-18392437,18392559-18392663,18392752-18392993,18393092-18393252,18393380-18393769