CLON SALKseq_062460.1  T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG CHRO chr1 EVAL 0 COOR W/18387800-18387800 NOTE KO415470 Salk 40K 1:18387800 TAACGCGCCAGGTAGGGGTCGAACCTACGACCTTCTGCTTAGGAAACAGACGCTCTATCCACTGAGCTACAGGCGCTT HITS AT1G49690.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G49690.1 tRNA ID=AT1G49690.1; Parent=AT1G49690; Note=tRNA-Arg; computational_description=tRNA-Arg (anticodon: CCT); Dbxref=PMID:8980477, PMID:23066098, PMID:8980477, locus:3686834; Name=AT1G49690.1; locus_type=pre_trna LOCN 300-UTR5 COOR W/18387802-18387874