CLON SALKseq_058657.0  T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG CHRO chr1 EVAL 0 COOR C/18406194-18406194 NOTE KO352287 Salk 40K 1:18406107 TGTGATAAAACGAATAATTATACCTTTGTCTTTATCTTGGAGAAGAAGAAAGGTATATTGTGGTGTAAACAAATTGAC HITS AT1G49730.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G49730.1 CDS ID=AT1G49730.1; Parent=AT1G49730; Name=AT1G49730.1; Note=Protein kinase superfamily protein; conf_class=3; computational_description=Protein kinase superfamily protein%3B FUNCTIONS IN: kinase activity%3B INVOLVED IN: protein amino acid phosphorylation%3B LOCATED IN: plasma membrane%3B EXPRESSED IN: 20 plant structures%3B EXPRESSED DURING: 13 growth stages%3B CONTAINS InterPro DOMAIN/s: Protein kinase%2C ATP binding site (InterPro:IPR017441)%2C Serine/threonine-protein kinase domain (InterPro:IPR002290)%2C Serine/threonine-protein kinase-like domain (InterPro:IPR017442)%2C Serine/threonine-protein kinase%2C active site (InterPro:IPR008271)%2C Protein kinase-like domain (InterPro:IPR011009)%2C Protein kinase%2C catalytic domain (InterPro:IPR000719)%2C Tyrosine-protein kinase%2C catalytic domain (InterPro:IPR020635)%3B BEST Arabidopsis thaliana protein match is: Protein kinase superfamily protein (TAIR:AT3G19300.1)%3B Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12%3B Bacteria - 1396%3B Metazoa - 17338%3B Fungi - 3422%3B Plants - 5037%3B Viruses - 0%3B Other Eukaryotes - 2996 (source: NCBI BLink).; conf_rating=****; Dbxref=PMID:12805585, PMID:21181499, PMID:21477822, locus:2012191; locus_type=protein_coding LOCN 1000-Promotor COOR C/18402618-18403126,18403205-18403289,18403366-18403455,18403560-18403627,18403709-18403761,18403846-18404110,18404191-18404478,18404548-18405102,18405470-18405638 HITS AT1G49730.4[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G49730.4 CDS ID=AT1G49730.4; Parent=AT1G49730; Name=AT1G49730.4; Note=Protein kinase superfamily protein; conf_class=1; computational_description=Protein kinase superfamily protein%3B FUNCTIONS IN: kinase activity%3B INVOLVED IN: protein amino acid phosphorylation%3B LOCATED IN: plasma membrane%3B EXPRESSED IN: 20 plant structures%3B EXPRESSED DURING: 13 growth stages%3B CONTAINS InterPro DOMAIN/s: Protein kinase%2C ATP binding site (InterPro:IPR017441)%2C Serine/threonine-protein kinase domain (InterPro:IPR002290)%2C Serine/threonine-protein kinase-like domain (InterPro:IPR017442)%2C Serine/threonine-protein kinase%2C active site (InterPro:IPR008271)%2C Protein kinase-like domain (InterPro:IPR011009)%2C Protein kinase%2C catalytic domain (InterPro:IPR000719)%2C Tyrosine-protein kinase%2C catalytic domain (InterPro:IPR020635)%3B BEST Arabidopsis thaliana protein match is: Protein kinase superfamily protein (TAIR:AT3G19300.1)%3B Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12%3B Bacteria - 1396%3B Metazoa - 17338%3B Fungi - 3422%3B Plants - 5037%3B Viruses - 0%3B Other Eukaryotes - 2996 (source: NCBI BLink).; conf_rating=*****; Dbxref=PMID:12805585, PMID:21181499, PMID:21477822, locus:2012191; locus_type=protein_coding LOCN 1000-Promotor COOR C/18402618-18402892,18403013-18403126,18403205-18403289,18403366-18403455,18403560-18403627,18403709-18403761,18403846-18404110,18404191-18404478,18404548-18405102,18405470-18405548 HITS AT1G49730.5[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G49730.5 CDS ID=AT1G49730.5; Parent=AT1G49730; Name=AT1G49730.5; Note=Protein kinase superfamily protein; computational_description=Protein kinase superfamily protein%3B FUNCTIONS IN: kinase activity%3B INVOLVED IN: protein amino acid phosphorylation%3B LOCATED IN: plasma membrane%3B EXPRESSED IN: 20 plant structures%3B EXPRESSED DURING: 13 growth stages%3B CONTAINS InterPro DOMAIN/s: Protein kinase%2C ATP binding site (InterPro:IPR017441)%2C Serine/threonine-protein kinase domain (InterPro:IPR002290)%2C Serine/threonine-protein kinase-like domain (InterPro:IPR017442)%2C Serine/threonine-protein kinase%2C active site (InterPro:IPR008271)%2C Protein kinase-like domain (InterPro:IPR011009)%2C Protein kinase%2C catalytic domain (InterPro:IPR000719)%2C Tyrosine-protein kinase%2C catalytic domain (InterPro:IPR020635)%3B BEST Arabidopsis thaliana protein match is: Protein kinase superfamily protein (TAIR:AT3G19300.1)%3B Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12%3B Bacteria - 1396%3B Metazoa - 17338%3B Fungi - 3422%3B Plants - 5037%3B Viruses - 0%3B Other Eukaryotes - 2996 (source: NCBI BLink).; Dbxref=PMID:12805585, PMID:21181499, PMID:21477822, locus:2012191; locus_type=protein_coding LOCN 1000-Promotor COOR C/18403433-18403492,18403560-18403627,18403709-18403761,18403846-18404110,18404191-18404478,18404548-18405102,18405470-18405638 HITS AT1G49730.2[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G49730.2 CDS ID=AT1G49730.2; Parent=AT1G49730; Name=AT1G49730.2; Note=Protein kinase superfamily protein; conf_class=1; computational_description=Protein kinase superfamily protein%3B FUNCTIONS IN: kinase activity%3B INVOLVED IN: protein amino acid phosphorylation%3B LOCATED IN: plasma membrane%3B EXPRESSED IN: 20 plant structures%3B EXPRESSED DURING: 13 growth stages%3B CONTAINS InterPro DOMAIN/s: Protein kinase%2C ATP binding site (InterPro:IPR017441)%2C Serine/threonine-protein kinase domain (InterPro:IPR002290)%2C Serine/threonine-protein kinase-like domain (InterPro:IPR017442)%2C Serine/threonine-protein kinase%2C active site (InterPro:IPR008271)%2C Protein kinase-like domain (InterPro:IPR011009)%2C Protein kinase%2C catalytic domain (InterPro:IPR000719)%2C Tyrosine-protein kinase%2C catalytic domain (InterPro:IPR020635)%3B BEST Arabidopsis thaliana protein match is: Protein kinase superfamily protein (TAIR:AT3G19300.1)%3B Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12%3B Bacteria - 1396%3B Metazoa - 17338%3B Fungi - 3422%3B Plants - 5037%3B Viruses - 0%3B Other Eukaryotes - 2996 (source: NCBI BLink).; conf_rating=*****; Dbxref=PMID:12805585, PMID:21181499, PMID:21477822, locus:2012191; locus_type=protein_coding LOCN 1000-Promotor COOR C/18403515-18403627,18403709-18403761,18403846-18404110,18404191-18404478,18404548-18405102,18405470-18405548