CLON SALKseq_055990.0  T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG CHRO chr1 EVAL 0 COOR C/54879-54879 NOTE KO412346 Salk 30K 1:54821 CGCCTTTTGCAGGATTGAAAAATACTAAAAGATAAAAAGATTTGAATCTTAGACAGGATATATTGTGGTGTAAACAAAT HITS AT1TE00150[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1TE00150 transposable_element ID=AT1TE00150; Name=AT1TE00150; Alias=SIMPLEHAT1 LOCN 1000-Promotor COOR W/55676-55873,55874-56576