CLON SALKseq_051628.1  T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG CHRO chr1 EVAL 0 COOR C/109105-109105 NOTE KO388744 Salk 30K 1:109046 AAAAAAGAGCACGAAGAACATGCGTCGGACTCTCTCTCTTCCTTGAATTCATTCAATTGTGGTGTAAACAAATTGACG HITS AT1G01260.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01260.1 CDS ID=AT1G01260.1; Parent=AT1G01260; Name=AT1G01260.1; Note=basic helix-loop-helix (bHLH) DNA-binding superfamily protein; conf_class=1; Alias=JAM2, Jasmonate Associated MYC2 LIKE 2; computational_description=basic helix-loop-helix (bHLH) DNA-binding superfamily protein%3B FUNCTIONS IN: DNA binding%2C sequence-specific DNA binding transcription factor activity%3B INVOLVED IN: regulation of transcription%3B LOCATED IN: nucleus%3B EXPRESSED IN: 24 plant structures%3B EXPRESSED DURING: 15 growth stages%3B CONTAINS InterPro DOMAIN/s: Helix-loop-helix DNA-binding domain (InterPro:IPR001092)%2C Helix-loop-helix DNA-binding (InterPro:IPR011598)%3B BEST Arabidopsis thaliana protein match is: ABA-inducible BHLH-type transcription factor (TAIR:AT2G46510.1)%3B Has 3647 Blast hits to 3273 proteins in 223 species: Archae - 0%3B Bacteria - 2%3B Metazoa - 174%3B Fungi - 93%3B Plants - 3336%3B Viruses - 0%3B Other Eukaryotes - 42 (source: NCBI BLink).; conf_rating=*****; Dbxref=PMID:11118137, PMID:12679534, PMID:12897250, PMID:14600211, PMID:15703057, PMID:16944199, PMID:17828375, PMID:18775970, PMID:21889054, PMID:22037706, PMID:23852442, PMID:24056034, PMID:24465948, locus:2035237; locus_type=protein_coding LOCN 1000-Promotor COOR W/109595-111367 HITS AT1G01260.2[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01260.2 CDS ID=AT1G01260.2; Parent=AT1G01260; Name=AT1G01260.2; Note=basic helix-loop-helix (bHLH) DNA-binding superfamily protein; conf_class=2; Alias=JAM2, Jasmonate Associated MYC2 LIKE 2; computational_description=basic helix-loop-helix (bHLH) DNA-binding superfamily protein%3B FUNCTIONS IN: DNA binding%2C sequence-specific DNA binding transcription factor activity%3B INVOLVED IN: regulation of transcription%3B LOCATED IN: nucleus%3B EXPRESSED IN: 24 plant structures%3B EXPRESSED DURING: 15 growth stages%3B CONTAINS InterPro DOMAIN/s: Helix-loop-helix DNA-binding domain (InterPro:IPR001092)%2C Helix-loop-helix DNA-binding (InterPro:IPR011598)%3B BEST Arabidopsis thaliana protein match is: ABA-inducible BHLH-type transcription factor (TAIR:AT2G46510.1)%3B Has 3647 Blast hits to 3273 proteins in 223 species: Archae - 0%3B Bacteria - 2%3B Metazoa - 174%3B Fungi - 93%3B Plants - 3336%3B Viruses - 0%3B Other Eukaryotes - 42 (source: NCBI BLink).; conf_rating=****; Dbxref=PMID:11118137, PMID:12679534, PMID:12897250, PMID:14600211, PMID:15703057, PMID:16944199, PMID:17828375, PMID:18775970, PMID:21889054, PMID:22037706, PMID:23852442, PMID:24056034, PMID:24465948, locus:2035237; locus_type=protein_coding LOCN 1000-Promotor COOR W/109595-111367 HITS AT1G01260.3[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01260.3 CDS ID=AT1G01260.3; Parent=AT1G01260; Name=AT1G01260.3; Note=basic helix-loop-helix (bHLH) DNA-binding superfamily protein; conf_class=4; Alias=JAM2, Jasmonate Associated MYC2 LIKE 2; computational_description=basic helix-loop-helix (bHLH) DNA-binding superfamily protein%3B FUNCTIONS IN: DNA binding%2C sequence-specific DNA binding transcription factor activity%3B INVOLVED IN: regulation of transcription%3B LOCATED IN: nucleus%3B EXPRESSED IN: 24 plant structures%3B EXPRESSED DURING: 15 growth stages%3B CONTAINS InterPro DOMAIN/s: Helix-loop-helix DNA-binding domain (InterPro:IPR001092)%2C Helix-loop-helix DNA-binding (InterPro:IPR011598)%3B BEST Arabidopsis thaliana protein match is: ABA-inducible BHLH-type transcription factor (TAIR:AT2G46510.1)%3B Has 3647 Blast hits to 3273 proteins in 223 species: Archae - 0%3B Bacteria - 2%3B Metazoa - 174%3B Fungi - 93%3B Plants - 3336%3B Viruses - 0%3B Other Eukaryotes - 42 (source: NCBI BLink).; conf_rating=***; Dbxref=PMID:11118137, PMID:12679534, PMID:12897250, PMID:14600211, PMID:15703057, PMID:16944199, PMID:17828375, PMID:18775970, PMID:21889054, PMID:22037706, PMID:23852442, PMID:24056034, PMID:24465948, locus:2035237; locus_type=protein_coding LOCN 1000-Promotor COOR W/109595-111367