CLON SALKseq_047636.1  T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG CHRO chr1 EVAL 0 COOR C/19832361-19832361 NOTE KO375179 Salk 30K 1:19832302 TCAAGAAAGCGACTCAAGAATGGGATTCTTGATCCGTGAAGCCCTGGCTAGTTCACATTATATTGTGGTGTAAACAAA HITS AT1G53180.2[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G53180.2 CDS ID=AT1G53180.2; Parent=AT1G53180; Name=AT1G53180.2; Note=hypothetical protein; computational_description=unknown protein%3B FUNCTIONS IN: molecular_function unknown%3B INVOLVED IN: biological_process unknown%3B LOCATED IN: cellular_component unknown%3B EXPRESSED IN: 13 plant structures%3B EXPRESSED DURING: 6 growth stages%3B BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G15115.1)%3B Has 58 Blast hits to 56 proteins in 22 species: Archae - 0%3B Bacteria - 0%3B Metazoa - 6%3B Fungi - 4%3B Plants - 29%3B Viruses - 0%3B Other Eukaryotes - 19 (source: NCBI BLink).; Dbxref=PMID:16212609, locus:2009565; locus_type=protein_coding LOCN Exon COOR W/19831363-19832370,19832440-19832727 HITS AT1G53180.3[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G53180.3 CDS ID=AT1G53180.3; Parent=AT1G53180; Name=AT1G53180.3; Note=hypothetical protein; computational_description=unknown protein%3B FUNCTIONS IN: molecular_function unknown%3B INVOLVED IN: biological_process unknown%3B LOCATED IN: cellular_component unknown%3B EXPRESSED IN: 13 plant structures%3B EXPRESSED DURING: 6 growth stages%3B BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G15115.1)%3B Has 58 Blast hits to 56 proteins in 22 species: Archae - 0%3B Bacteria - 0%3B Metazoa - 6%3B Fungi - 4%3B Plants - 29%3B Viruses - 0%3B Other Eukaryotes - 19 (source: NCBI BLink).; Dbxref=PMID:16212609, locus:2009565; locus_type=protein_coding LOCN Exon COOR W/19831396-19832370,19832440-19832727 HITS AT1G53180.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G53180.1 CDS ID=AT1G53180.1; Parent=AT1G53180; Name=AT1G53180.1; Note=hypothetical protein; conf_class=2; computational_description=unknown protein%3B FUNCTIONS IN: molecular_function unknown%3B INVOLVED IN: biological_process unknown%3B LOCATED IN: cellular_component unknown%3B EXPRESSED IN: 13 plant structures%3B EXPRESSED DURING: 6 growth stages%3B BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G15115.1)%3B Has 58 Blast hits to 56 proteins in 22 species: Archae - 0%3B Bacteria - 0%3B Metazoa - 6%3B Fungi - 4%3B Plants - 29%3B Viruses - 0%3B Other Eukaryotes - 19 (source: NCBI BLink).; conf_rating=****; Dbxref=PMID:16212609, locus:2009565; locus_type=protein_coding LOCN Exon COOR W/19831582-19832370,19832440-19832727