CLON SALKseq_046278.1  T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG CHRO chr1 EVAL 0 COOR C/11933-11933 NOTE KO381801 Salk 20K 1:11785 AAATTGAGAGAAAGTGAAGACTTCCCTTTCTTAGCAAATTGATCATCATCGCCATCATCAACAAATTGACGCTTAGACA HITS AT1G01030.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01030.1 CDS ID=AT1G01030.1; Parent=AT1G01030; Name=AT1G01030.1; Note=AP2/B3-like transcriptional factor family protein; conf_class=2; symbol=NGA3; full_name=NGATHA3; computational_description=NGATHA3 (NGA3)%3B CONTAINS InterPro DOMAIN/s: Transcriptional factor B3 (InterPro:IPR003340)%3B BEST Arabidopsis thaliana protein match is: AP2/B3-like transcriptional factor family protein (TAIR:AT4G01500.1)%3B Has 1380 Blast hits to 1379 proteins in 72 species: Archae - 0%3B Bacteria - 0%3B Metazoa - 0%3B Fungi - 0%3B Plants - 1380%3B Viruses - 0%3B Other Eukaryotes - 0 (source: NCBI BLink).; conf_rating=****; Dbxref=PMID:11118137, PMID:15010618, PMID:16603651, PMID:16709272, PMID:16944199, PMID:18650403, PMID:19324928, PMID:19435937, PMID:20736450, PMID:22995285, PMID:24377444, PMID:25625546, locus:2200950; locus_type=protein_coding LOCN Exon COOR C/11864-12940 HITS AT1G01030.2[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01030.2 CDS ID=AT1G01030.2; Parent=AT1G01030; Name=AT1G01030.2; Note=AP2/B3-like transcriptional factor family protein; symbol=NGA3; full_name=NGATHA3; computational_description=NGATHA3 (NGA3)%3B CONTAINS InterPro DOMAIN/s: Transcriptional factor B3 (InterPro:IPR003340)%3B BEST Arabidopsis thaliana protein match is: AP2/B3-like transcriptional factor family protein (TAIR:AT4G01500.1)%3B Has 1380 Blast hits to 1379 proteins in 72 species: Archae - 0%3B Bacteria - 0%3B Metazoa - 0%3B Fungi - 0%3B Plants - 1380%3B Viruses - 0%3B Other Eukaryotes - 0 (source: NCBI BLink).; Dbxref=PMID:11118137, PMID:15010618, PMID:16603651, PMID:16709272, PMID:16944199, PMID:18650403, PMID:19324928, PMID:19435937, PMID:20736450, PMID:22995285, PMID:24377444, PMID:25625546, locus:2200950; locus_type=protein_coding LOCN Exon COOR C/11864-12354,12424-12940 HITS AT1TE00010[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1TE00010 transposable_element ID=AT1TE00010; Name=AT1TE00010; Alias=ATCOPIA24 LOCN Exon COOR W/11897-11976