CLON SALKseq_046054.0  T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG CHRO chr1 EVAL 0 COOR W/98110-98110 NOTE KO368385 Salk 20K 1:98109 ATCAACTCAACAGTCAACACTGCTGATAGTATCCAAACAGATCAATTCAAAATCGCTGAACACATTGACGCTTAGACAA HITS AT1G01230.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01230.1 CDS ID=AT1G01230.1; Parent=AT1G01230; Name=AT1G01230.1; Note=ORMDL family protein; conf_class=2; computational_description=ORMDL family protein%3B FUNCTIONS IN: molecular_function unknown%3B INVOLVED IN: protein folding%3B LOCATED IN: integral to membrane%2C endoplasmic reticulum%3B EXPRESSED IN: 24 plant structures%3B EXPRESSED DURING: 15 growth stages%3B CONTAINS InterPro DOMAIN/s: ORMDL (InterPro:IPR007203)%3B BEST Arabidopsis thaliana protein match is: ORMDL family protein (TAIR:AT5G42000.1)%3B Has 538 Blast hits to 538 proteins in 163 species: Archae - 0%3B Bacteria - 0%3B Metazoa - 276%3B Fungi - 148%3B Plants - 90%3B Viruses - 0%3B Other Eukaryotes - 24 (source: NCBI BLink).; conf_rating=****; Dbxref=PMID:15703057, PMID:18775970, locus:2035352; locus_type=protein_coding LOCN Intron COOR W/97620-97805,98457-98605,98908-99046