CLON SALKseq_045822.1  T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG CHRO chr1 EVAL 0 COOR W/19875497-19875497 NOTE KO368374 Salk 20K 1:19875496 ACCATCATCACTGGTTTCTCTGTTAGATGTGATTACGCTGCATGCCAGTGTTGCGGTGTAAACAAATTGACGCTTAGAC HITS AT1TE65700[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [NCBI] [KEGG] [Protein Interaction] [AtGene Express] [AtGDB View]
[e-FP Browser] [AthaMap] [Phosphat] [Methylome] [UToronto BAR Expression Angler] [Araport ] [TAIR ]
Genome Browsers: [1001 Genomes] [1001 Epigenomes] [ABA TF Network] TYPE Gene TITL AT1TE65700 transposable_element AT1TE65700 ID=AT1TE65700; Name=AT1TE65700; Alias=ATHATN2 LOCN 300-UTR3 COOR W/19874972-19875199 HITS AT1TE65705[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [NCBI] [KEGG] [Protein Interaction] [AtGene Express] [AtGDB View]
[e-FP Browser] [AthaMap] [Phosphat] [Methylome] [UToronto BAR Expression Angler] [Araport ] [TAIR ]
Genome Browsers: [1001 Genomes] [1001 Epigenomes] [ABA TF Network] TYPE Gene TITL AT1TE65705 transposable_element AT1TE65705 ID=AT1TE65705; Name=AT1TE65705; Alias=ATHAT1 LOCN 1000-Promotor COOR W/19876058-19876222 HITS AT1TE65710[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [NCBI] [KEGG] [Protein Interaction] [AtGene Express] [AtGDB View]
[e-FP Browser] [AthaMap] [Phosphat] [Methylome] [UToronto BAR Expression Angler] [Araport ] [TAIR ]
Genome Browsers: [1001 Genomes] [1001 Epigenomes] [ABA TF Network] TYPE Gene TITL AT1TE65710 transposable_element AT1TE65710 ID=AT1TE65710; Name=AT1TE65710; Alias=ATREP15 LOCN 1000-Promotor COOR W/19876248-19877040