CLON SALKseq_039814.2  T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG CHRO chr2 EVAL 0 COOR W/16993453-16993453 NOTE KO378154 Salk 10K 2:16993452 CAAATTTTGTACCTTAAACAATTCACTGTTTTTCGCTTCTTTACAAATTGACAAATTGTGGTGAAAACAAATTGACACA HITS AT2G40730.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT2G40730.1 CDS ID=AT2G40730.1; Parent=AT2G40730; Name=AT2G40730.1; Note=kinase family with ARM repeat domain-containing protein; conf_class=2; symbol=CTEXP; full_name=cytoplasmic tRNA export protein; computational_description=Protein kinase family protein with ARM repeat domain%3B FUNCTIONS IN: protein serine/threonine kinase activity%2C binding%2C protein kinase activity%2C ATP binding%3B INVOLVED IN: protein amino acid phosphorylation%3B LOCATED IN: cellular_component unknown%3B EXPRESSED IN: 23 plant structures%3B EXPRESSED DURING: 14 growth stages%3B CONTAINS InterPro DOMAIN/s: Protein kinase%2C catalytic domain (InterPro:IPR000719)%2C Armadillo-like helical (InterPro:IPR011989)%2C Serine/threonine-protein kinase domain (InterPro:IPR002290)%2C HEAT%2C type 2 (InterPro:IPR021133)%2C Armadillo-type fold (InterPro:IPR016024)%2C Serine/threonine-protein kinase-like domain (InterPro:IPR017442)%2C Protein kinase-like domain (InterPro:IPR011009)%3B BEST Arabidopsis thaliana protein match is: ARM repeat superfamily protein (TAIR:AT1G71410.1)%3B Has 4566 Blast hits to 2083 proteins in 348 species: Archae - 0%3B Bacteria - 278%3B Metazoa - 876%3B Fungi - 585%3B Plants - 192%3B Viruses - 19%3B Other Eukaryotes - 2616 (source: NCBI BLink).; conf_rating=****; Dbxref=PMID:18775970, PMID:21477822, locus:2064821; locus_type=protein_coding LOCN Intron COOR C/16990083-16990369,16990455-16990706,16990935-16991047,16991145-16991212,16991324-16991393,16991483-16991582,16991720-16991795,16991904-16991978,16992304-16992357,16992541-16992630,16992743-16992859,16992965-16993075,16993176-16993315,16993519-16993600,16993846-16993925,16994038-16994146,16994389-16994511,16994613-16994685,16994843-16994994,16995389-16995487,16995947-16996072