CLON SALKseq_038651.1  T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG CHRO chr1 EVAL 0 COOR C/14902-14902 NOTE KO371391 Salk 10K 1:14846 AATTAATTACCCAATATTTTGTTTGGTATAGTTAATTATGCAATTATTTACAGATATATTGTGGTGTAAACAAATTGAC