CLON SALKseq_037032.1  T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG CHRO chr1 EVAL 0 COOR C/19873718-19873718 NOTE KO374640 Salk 10K 1:19873719 CAAAAATGCCAAAGTGATAAAGTATAGGTACATTACATAAGTTGTCAATTTGTGTTATTGTGGTGTAAACAAATTGAC