CLON SALKseq_035378.0  T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG CHRO chr1 EVAL 0 COOR C/101831-101831 NOTE KO407999 Salk 10K 1:101821 TAAAATTGTGTGTATATTTTGTTAATGTATGTATTGTGTGATGTTTGTGTAAATTTAATCTTCTGTAGAAGTTTATTTG HITS AT1G01240.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01240.1 CDS ID=AT1G01240.1; Parent=AT1G01240; Name=AT1G01240.1; Note=transmembrane protein; conf_class=4; computational_description=unknown protein%3B INVOLVED IN: N-terminal protein myristoylation%3B EXPRESSED IN: 17 plant structures%3B EXPRESSED DURING: 11 growth stages%3B BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G46550.1)%3B Has 95 Blast hits to 78 proteins in 16 species: Archae - 0%3B Bacteria - 2%3B Metazoa - 11%3B Fungi - 0%3B Plants - 80%3B Viruses - 0%3B Other Eukaryotes - 2 (source: NCBI BLink).; conf_rating=***; Dbxref=PMID:12912986, PMID:15703057, PMID:23517122, locus:2035242; locus_type=protein_coding LOCN 300-UTR3 COOR W/100683-101678 HITS AT1G01240.2[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01240.2 CDS ID=AT1G01240.2; Parent=AT1G01240; Name=AT1G01240.2; Note=transmembrane protein; conf_class=2; computational_description=unknown protein%3B INVOLVED IN: N-terminal protein myristoylation%3B EXPRESSED IN: 17 plant structures%3B EXPRESSED DURING: 11 growth stages%3B BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G46550.1)%3B Has 95 Blast hits to 78 proteins in 16 species: Archae - 0%3B Bacteria - 2%3B Metazoa - 11%3B Fungi - 0%3B Plants - 80%3B Viruses - 0%3B Other Eukaryotes - 2 (source: NCBI BLink).; conf_rating=****; Dbxref=PMID:12912986, PMID:15703057, PMID:23517122, locus:2035242; locus_type=protein_coding LOCN 300-UTR3 COOR W/100683-101678 HITS AT1G01240.3[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01240.3 CDS ID=AT1G01240.3; Parent=AT1G01240; Name=AT1G01240.3; Note=transmembrane protein; conf_class=4; computational_description=unknown protein%3B INVOLVED IN: N-terminal protein myristoylation%3B EXPRESSED IN: 17 plant structures%3B EXPRESSED DURING: 11 growth stages%3B BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G46550.1)%3B Has 95 Blast hits to 78 proteins in 16 species: Archae - 0%3B Bacteria - 2%3B Metazoa - 11%3B Fungi - 0%3B Plants - 80%3B Viruses - 0%3B Other Eukaryotes - 2 (source: NCBI BLink).; conf_rating=***; Dbxref=PMID:12912986, PMID:15703057, PMID:23517122, locus:2035242; locus_type=protein_coding LOCN 300-UTR3 COOR W/100683-101678 HITS AT1G01240.4[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01240.4 CDS ID=AT1G01240.4; Parent=AT1G01240; Name=AT1G01240.4; Note=transmembrane protein; Dbxref=PMID:12912986, PMID:15703057, PMID:23517122, locus:2035242; computational_description=unknown protein%3B INVOLVED IN: N-terminal protein myristoylation%3B EXPRESSED IN: 17 plant structures%3B EXPRESSED DURING: 11 growth stages%3B BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G46550.1)%3B Has 95 Blast hits to 78 proteins in 16 species: Archae - 0%3B Bacteria - 2%3B Metazoa - 11%3B Fungi - 0%3B Plants - 80%3B Viruses - 0%3B Other Eukaryotes - 2 (source: NCBI BLink).; locus_type=protein_coding LOCN 300-UTR3 COOR W/100683-101678 HITS AT1G01240.5[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01240.5 CDS ID=AT1G01240.5; Parent=AT1G01240; Name=AT1G01240.5; Note=transmembrane protein; Dbxref=PMID:12912986, PMID:15703057, PMID:23517122, locus:2035242; computational_description=unknown protein%3B INVOLVED IN: N-terminal protein myristoylation%3B EXPRESSED IN: 17 plant structures%3B EXPRESSED DURING: 11 growth stages%3B BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G46550.1)%3B Has 95 Blast hits to 78 proteins in 16 species: Archae - 0%3B Bacteria - 2%3B Metazoa - 11%3B Fungi - 0%3B Plants - 80%3B Viruses - 0%3B Other Eukaryotes - 2 (source: NCBI BLink).; locus_type=protein_coding LOCN 300-UTR3 COOR W/100683-101678