CLON SALKseq_030840.1  T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG CHRO chr2 EVAL 0 COOR W/17005018-17005018 NOTE KO391092 Salk 10K 2:17005014 TAGAAATAAAACAAATCACTAGGTTACAAAAAAAACGGTTTAGTACAAATTAAAACTTGATAGTTTGAGATCTGAGTAG HITS AT2TE76580[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT2TE76580 transposable_element ID=AT2TE76580; Name=AT2TE76580; Alias=ATREP10D LOCN 300-UTR5 COOR W/17005214-17005419