CLON SAILseq_554_F11.1  T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG CHRO chr1 EVAL 0 COOR W/88782-88782 NOTE KO329325 SAIL 30K 1:88849 AATACTTTAATTGTTTCACCCCAACTTTTATTGGGCCTAAAATATCACGTAGGCCCAACTTATGCTACAATCCATATATTTAATTTTTCAGCAAC HITS AT1G01200.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01200.1 CDS ID=AT1G01200.1; Parent=AT1G01200; Name=AT1G01200.1; Note=RAB GTPase homolog A3; conf_class=1; symbol=RABA3; Alias=ATRAB-A3, ARABIDOPSIS RAB GTPASE HOMOLOG A3, ATRABA3, RAB GTPase homolog A3; full_name=RAB GTPase homolog A3; computational_description=RAB GTPase homolog A3 (RABA3)%3B FUNCTIONS IN: GTP binding%3B INVOLVED IN: protein transport%2C small GTPase mediated signal transduction%3B LOCATED IN: endosome%2C nucleus%2C cell plate%3B EXPRESSED IN: lateral root cap%2C hypocotyl%2C root%2C flower%2C epidermis%3B EXPRESSED DURING: petal differentiation and expansion stage%3B CONTAINS InterPro DOMAIN/s: Ras GTPase (InterPro:IPR001806)%2C Small GTP-binding protein (InterPro:IPR005225)%2C Small GTPase (InterPro:IPR020851)%2C Ras (InterPro:IPR013753)%2C Ras small GTPase%2C Rab type (InterPro:IPR003579)%2C Rab11-related (InterPro:IPR015595)%3B BEST Arabidopsis thaliana protein match is: RAB GTPase homolog A4C (TAIR:AT5G47960.1)%3B Has 27164 Blast hits to 27137 proteins in 734 species: Archae - 19%3B Bacteria - 134%3B Metazoa - 14292%3B Fungi - 3779%3B Plants - 3194%3B Viruses - 20%3B Other Eukaryotes - 5726 (source: NCBI BLink).; conf_rating=*****; Dbxref=PMID:12644670, PMID:15703057, PMID:16581873, PMID:18239134, locus:2035302; locus_type=protein_coding LOCN 1000-Promotor COOR C/86715-87162,87880-88145 HITS AT1G01210.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01210.1 CDS ID=AT1G01210.1; Parent=AT1G01210; Name=AT1G01210.1; Note=DNA-directed RNA polymerase%2C subunit M%2C archaeal; conf_class=1; computational_description=DNA-directed RNA polymerase%2C subunit M%2C archaeal%3B FUNCTIONS IN: in 6 functions%3B INVOLVED IN: RNA elongation%2C regulation of transcription%2C DNA-dependent%2C transcription%2C regulation of transcription%3B LOCATED IN: nucleus%3B CONTAINS InterPro DOMAIN/s: Zinc finger%2C TFIIS-type (InterPro:IPR001222)%2C DNA-directed RNA polymerase%2C M/15kDa subunit (InterPro:IPR001529)%2C DNA-directed RNA polymerase%2C subunit M%2C archaeal (InterPro:IPR006288)%2C DNA-directed RNA polymerase M%2C 15kDa subunit%2C conserved site (InterPro:IPR019761)%3B BEST Arabidopsis thaliana protein match is: DNA-directed RNA polymerase%2C subunit M%2C archaeal (TAIR:AT4G07950.1)%3B Has 1129 Blast hits to 1129 proteins in 326 species: Archae - 242%3B Bacteria - 0%3B Metazoa - 276%3B Fungi - 294%3B Plants - 112%3B Viruses - 0%3B Other Eukaryotes - 205 (source: NCBI BLink).; conf_rating=*****; Dbxref=PMID:17447913, locus:2035322; locus_type=protein_coding LOCN 300-UTR5 COOR W/88977-89081,89173-89263,89405-89529 HITS AT1G01210.2[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01210.2 CDS ID=AT1G01210.2; Parent=AT1G01210; Name=AT1G01210.2; Note=DNA-directed RNA polymerase%2C subunit M%2C archaeal; Dbxref=PMID:17447913, locus:2035322; computational_description=DNA-directed RNA polymerase%2C subunit M%2C archaeal%3B FUNCTIONS IN: in 6 functions%3B INVOLVED IN: RNA elongation%2C regulation of transcription%2C DNA-dependent%2C transcription%2C regulation of transcription%3B LOCATED IN: nucleus%3B CONTAINS InterPro DOMAIN/s: Zinc finger%2C TFIIS-type (InterPro:IPR001222)%2C DNA-directed RNA polymerase%2C M/15kDa subunit (InterPro:IPR001529)%2C DNA-directed RNA polymerase%2C subunit M%2C archaeal (InterPro:IPR006288)%2C DNA-directed RNA polymerase M%2C 15kDa subunit%2C conserved site (InterPro:IPR019761)%3B BEST Arabidopsis thaliana protein match is: DNA-directed RNA polymerase%2C subunit M%2C archaeal (TAIR:AT4G07950.1)%3B Has 1129 Blast hits to 1129 proteins in 326 species: Archae - 242%3B Bacteria - 0%3B Metazoa - 276%3B Fungi - 294%3B Plants - 112%3B Viruses - 0%3B Other Eukaryotes - 205 (source: NCBI BLink).; locus_type=protein_coding LOCN 300-UTR5 COOR W/88977-89081,89173-89263,89405-89529 HITS AT1G01210.3[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01210.3 CDS ID=AT1G01210.3; Parent=AT1G01210; Name=AT1G01210.3; Note=DNA-directed RNA polymerase%2C subunit M%2C archaeal; Dbxref=PMID:17447913, locus:2035322; computational_description=DNA-directed RNA polymerase%2C subunit M%2C archaeal%3B FUNCTIONS IN: in 6 functions%3B INVOLVED IN: RNA elongation%2C regulation of transcription%2C DNA-dependent%2C transcription%2C regulation of transcription%3B LOCATED IN: nucleus%3B CONTAINS InterPro DOMAIN/s: Zinc finger%2C TFIIS-type (InterPro:IPR001222)%2C DNA-directed RNA polymerase%2C M/15kDa subunit (InterPro:IPR001529)%2C DNA-directed RNA polymerase%2C subunit M%2C archaeal (InterPro:IPR006288)%2C DNA-directed RNA polymerase M%2C 15kDa subunit%2C conserved site (InterPro:IPR019761)%3B BEST Arabidopsis thaliana protein match is: DNA-directed RNA polymerase%2C subunit M%2C archaeal (TAIR:AT4G07950.1)%3B Has 1129 Blast hits to 1129 proteins in 326 species: Archae - 242%3B Bacteria - 0%3B Metazoa - 276%3B Fungi - 294%3B Plants - 112%3B Viruses - 0%3B Other Eukaryotes - 205 (source: NCBI BLink).; locus_type=protein_coding LOCN 300-UTR5 COOR W/88977-89081,89173-89263,89405-89529