CLON SAILseq_383_H08.1  T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG CHRO chr1 EVAL 0 COOR C/18385662-18385662 NOTE KO336451 SAIL 30K 1:18385626 ATCAGCGACTGTTACAAAAACTCCTTTCTCTGCACGAGCTCAGCAGAGAGATCGACATACACATAATTGACGCTTAGACAACATAATGTTAGCAG HITS AT1G49670.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G49670.1 CDS ID=AT1G49670.1; Parent=AT1G49670; Name=AT1G49670.1; Note=ARP protein (REF); curator_summary=molecular function has not been defined. Was shown involved in oxidative stress tolerance.; conf_class=3; symbol=NQR; computational_description=NQR%3B FUNCTIONS IN: oxidoreductase activity%2C binding%2C catalytic activity%2C zinc ion binding%3B INVOLVED IN: response to oxidative stress%2C metabolic process%3B LOCATED IN: mitochondrion%2C peroxisome%3B EXPRESSED IN: 24 plant structures%3B EXPRESSED DURING: 13 growth stages%3B CONTAINS InterPro DOMAIN/s: Short-chain dehydrogenase/reductase%2C conserved site (InterPro:IPR020904)%2C Glucose/ribitol dehydrogenase (InterPro:IPR002347)%2C Alcohol dehydrogenase%2C C-terminal (InterPro:IPR013149)%2C Short-chain dehydrogenase/reductase SDR (InterPro:IPR002198)%2C GroES-like (InterPro:IPR011032)%2C NAD(P)-binding domain (InterPro:IPR016040)%2C Alcohol dehydrogenase GroES-like (InterPro:IPR013154)%2C Quinone oxidoreductase/zeta-crystallin%2C conserved site (InterPro:IPR002364)%2C Alcohol dehydrogenase superfamily%2C zinc-containing (InterPro:IPR002085)%3B BEST Arabidopsis thaliana protein match is: Zinc-binding dehydrogenase family protein (TAIR:AT5G37980.1)%3B Has 139834 Blast hits to 139487 proteins in 3900 species: Archae - 1368%3B Bacteria - 93458%3B Metazoa - 6844%3B Fungi - 8617%3B Plants - 3827%3B Viruses - 2%3B Other Eukaryotes - 25718 (source: NCBI BLink).; conf_rating=****; Dbxref=PMID:7592828, PMID:14701923, PMID:14671022, PMID:17631525, PMID:17951448, PMID:18775970, PMID:18931141, PMID:19043666, PMID:20736450, locus:2012166; locus_type=protein_coding LOCN Intron COOR C/18381591-18381641,18381848-18381934,18382055-18382141,18382260-18382337,18382451-18382579,18382655-18382774,18382886-18382960,18383117-18383212,18383300-18383401,18383469-18383537,18383701-18383827,18383933-18384119,18384473-18384560,18384830-18384906,18385008-18385113,18385202-18385383,18385475-18385648,18385967-18386021 HITS AT1G49670.2[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G49670.2 CDS ID=AT1G49670.2; Parent=AT1G49670; Name=AT1G49670.2; Note=ARP protein (REF); curator_summary=molecular function has not been defined. Was shown involved in oxidative stress tolerance.; conf_class=4; symbol=NQR; computational_description=NQR%3B FUNCTIONS IN: oxidoreductase activity%2C binding%2C catalytic activity%2C zinc ion binding%3B INVOLVED IN: response to oxidative stress%2C metabolic process%3B LOCATED IN: mitochondrion%2C peroxisome%3B EXPRESSED IN: 24 plant structures%3B EXPRESSED DURING: 13 growth stages%3B CONTAINS InterPro DOMAIN/s: Short-chain dehydrogenase/reductase%2C conserved site (InterPro:IPR020904)%2C Glucose/ribitol dehydrogenase (InterPro:IPR002347)%2C Alcohol dehydrogenase%2C C-terminal (InterPro:IPR013149)%2C Short-chain dehydrogenase/reductase SDR (InterPro:IPR002198)%2C GroES-like (InterPro:IPR011032)%2C NAD(P)-binding domain (InterPro:IPR016040)%2C Alcohol dehydrogenase GroES-like (InterPro:IPR013154)%2C Quinone oxidoreductase/zeta-crystallin%2C conserved site (InterPro:IPR002364)%2C Alcohol dehydrogenase superfamily%2C zinc-containing (InterPro:IPR002085)%3B BEST Arabidopsis thaliana protein match is: Zinc-binding dehydrogenase family protein (TAIR:AT5G37980.1)%3B Has 139834 Blast hits to 139487 proteins in 3900 species: Archae - 1368%3B Bacteria - 93458%3B Metazoa - 6844%3B Fungi - 8617%3B Plants - 3827%3B Viruses - 2%3B Other Eukaryotes - 25718 (source: NCBI BLink).; conf_rating=***; Dbxref=PMID:7592828, PMID:14701923, PMID:14671022, PMID:17631525, PMID:17951448, PMID:18775970, PMID:18931141, PMID:19043666, PMID:20736450, locus:2012166; locus_type=protein_coding LOCN Intron COOR C/18381591-18381641,18381848-18381934,18382055-18382141,18382260-18382337,18382451-18382579,18382655-18382774,18382886-18383029,18383117-18383212,18383300-18383401,18383469-18383537,18383701-18383827,18383933-18384119,18384473-18384560,18384830-18384906,18385008-18385113,18385202-18385383,18385475-18385648,18385967-18386021