CLON GABIseq_535A12.1  T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG CHRO chr1 EVAL 0 COOR C/76059-76059 NOTE KG787536 GABI 10K 1:76032 AAGAATCAAAGGTTGGGGATCATACGGGGCCGTTTTCGAGAATCTAATCCGCCGAGTCAAACCTAAGACGATCGTCGAAGTCAGGATATATTCAATTGTA HITS AT1G01180.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01180.1 CDS ID=AT1G01180.1; Parent=AT1G01180; Name=AT1G01180.1; Note=S-adenosyl-L-methionine-dependent methyltransferases superfamily protein; conf_class=1; computational_description=S-adenosyl-L-methionine-dependent methyltransferases superfamily protein%3B FUNCTIONS IN: methyltransferase activity%3B INVOLVED IN: lipid biosynthetic process%3B EXPRESSED IN: sperm cell%2C hypocotyl%3B CONTAINS InterPro DOMAIN/s: Rhamnosyl O-methyltransferase/Cephalosporin hydroxylase (InterPro:IPR007072)%3B Has 274 Blast hits to 274 proteins in 51 species: Archae - 0%3B Bacteria - 75%3B Metazoa - 2%3B Fungi - 0%3B Plants - 46%3B Viruses - 0%3B Other Eukaryotes - 151 (source: NCBI BLink).; conf_rating=*****; Dbxref=PMID:12101121, PMID:15703057, PMID:16520461, locus:2035262; locus_type=protein_coding LOCN Exon COOR W/75633-76556 HITS AT1TE00220[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1TE00220 transposable_element ID=AT1TE00220; Name=AT1TE00220; Alias=TA11 LOCN 1000-Promotor COOR W/76844-77500