CLON GABIseq_410A02.1  T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG CHRO chr1 EVAL 0 COOR C/18407062-18407062 NOTE KG785016 GABI 10K 1:18407040 CCAGACCCAAACTATGTGTGAACTGGTTTAAGGATATTGTTGGCAAAGTGGGCTATGATTGGGCCGGCTGAATGGATCATCATATTCAATTGTAAATGGC HITS AT1G49740.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G49740.1 CDS ID=AT1G49740.1; Parent=AT1G49740; Name=AT1G49740.1; Note=PLC-like phosphodiesterases superfamily protein; conf_class=2; computational_description=PLC-like phosphodiesterases superfamily protein%3B FUNCTIONS IN: phospholipase C activity%2C phosphoric diester hydrolase activity%3B INVOLVED IN: intracellular signaling pathway%2C lipid metabolic process%3B LOCATED IN: endomembrane system%3B EXPRESSED IN: 22 plant structures%3B EXPRESSED DURING: 13 growth stages%3B CONTAINS InterPro DOMAIN/s: Phospholipase C%2C phosphatidylinositol-specific %2C X domain (InterPro:IPR000909)%2C PLC-like phosphodiesterase%2C TIM beta/alpha-barrel domain (InterPro:IPR017946)%3B BEST Arabidopsis thaliana protein match is: PLC-like phosphodiesterases superfamily protein (TAIR:AT3G19310.1)%3B Has 451 Blast hits to 448 proteins in 104 species: Archae - 0%3B Bacteria - 81%3B Metazoa - 8%3B Fungi - 159%3B Plants - 152%3B Viruses - 0%3B Other Eukaryotes - 51 (source: NCBI BLink).; conf_rating=****; Dbxref=PMID:14985976, locus:2012181; locus_type=protein_coding LOCN 1000-Promotor COOR W/18407728-18407811,18408032-18408292,18408373-18408471,18408580-18408883,18408975-18409198,18409278-18409364,18409448-18409468