CLON GABIseq_382G10.1  T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG CHRO chr1 EVAL 0 COOR C/19830470-19830470 NOTE KG784448 GABI 10K 1:19830448 TGTGAAAGGTCTTTCCAAGTGGGAGGGAAAAAACCCCAACTGATTTTACTTTTGGAAATATTTTAATGCCGATAAATATTTCAGGATATATTCAATTGTA HITS AT1G53180.2[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [NCBI] [KEGG] [Protein Interaction] [AtGene Express] [AtGDB View]
[e-FP Browser] [AthaMap] [Phosphat] [Methylome] [UToronto BAR Expression Angler] [Araport ] [TAIR ]
Genome Browsers: [1001 Genomes] [1001 Epigenomes] [ABA TF Network] TYPE Gene TITL AT1G53180.2 CDS AT1G53180 ID=AT1G53180.2; Parent=AT1G53180; Name=AT1G53180.2; Note=hypothetical protein; computational_description=unknown protein%3B FUNCTIONS IN: molecular_function unknown%3B INVOLVED IN: biological_process unknown%3B LOCATED IN: cellular_component unknown%3B EXPRESSED IN: 13 plant structures%3B EXPRESSED DURING: 6 growth stages%3B BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G15115.1)%3B Has 58 Blast hits to 56 proteins in 22 species: Archae - 0%3B Bacteria - 0%3B Metazoa - 6%3B Fungi - 4%3B Plants - 29%3B Viruses - 0%3B Other Eukaryotes - 19 (source: NCBI BLink).; Dbxref=PMID:16212609, locus:2009565; locus_type=protein_coding LOCN 1000-Promotor COOR W/19831363-19832370,19832440-19832727 HITS AT1G53180.3[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [NCBI] [KEGG] [Protein Interaction] [AtGene Express] [AtGDB View]
[e-FP Browser] [AthaMap] [Phosphat] [Methylome] [UToronto BAR Expression Angler] [Araport ] [TAIR ]
Genome Browsers: [1001 Genomes] [1001 Epigenomes] [ABA TF Network] TYPE Gene TITL AT1G53180.3 CDS AT1G53180 ID=AT1G53180.3; Parent=AT1G53180; Name=AT1G53180.3; Note=hypothetical protein; computational_description=unknown protein%3B FUNCTIONS IN: molecular_function unknown%3B INVOLVED IN: biological_process unknown%3B LOCATED IN: cellular_component unknown%3B EXPRESSED IN: 13 plant structures%3B EXPRESSED DURING: 6 growth stages%3B BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G15115.1)%3B Has 58 Blast hits to 56 proteins in 22 species: Archae - 0%3B Bacteria - 0%3B Metazoa - 6%3B Fungi - 4%3B Plants - 29%3B Viruses - 0%3B Other Eukaryotes - 19 (source: NCBI BLink).; Dbxref=PMID:16212609, locus:2009565; locus_type=protein_coding LOCN 1000-Promotor COOR W/19831396-19832370,19832440-19832727