CLON GABIseq_376F07.2  T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG CHRO chr1 EVAL 0 COOR W/72124-72124 NOTE KG784401 GABI 10K 1:72170 GGACCATCGAGAAAGTTACATTGCAAAGTACTACATTGAGTCAGTTTCTTCCTTCTTCGCCTAAATTCGAAATTTCGCCGAATATATTCAATTGTAAATG HITS AT1G01150.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01150.1 CDS ID=AT1G01150.1; Parent=AT1G01150; Name=AT1G01150.1; Note=Homeodomain-like protein with RING/FYVE/PHD-type zinc finger domain-containing protein; conf_class=6; computational_description=Homeodomain-like protein with RING/FYVE/PHD-type zinc finger domain%3B FUNCTIONS IN: DNA binding%2C zinc ion binding%3B INVOLVED IN: regulation of transcription%3B EXPRESSED IN: 8 plant structures%3B EXPRESSED DURING: 4 anthesis%2C petal differentiation and expansion stage%2C E expanded cotyledon stage%2C D bilateral stage%3B CONTAINS InterPro DOMAIN/s: Homeodomain-like (InterPro:IPR009057)%2C Zinc finger%2C PHD-type%2C conserved site (InterPro:IPR019786)%2C Zinc finger%2C FYVE/PHD-type (InterPro:IPR011011)%2C Homeodomain-related (InterPro:IPR012287)%2C MYB-like (InterPro:IPR017877)%3B BEST Arabidopsis thaliana protein match is: TRF-like 10 (TAIR:AT5G03780.1)%3B Has 94 Blast hits to 77 proteins in 18 species: Archae - 0%3B Bacteria - 0%3B Metazoa - 5%3B Fungi - 0%3B Plants - 86%3B Viruses - 0%3B Other Eukaryotes - 3 (source: NCBI BLink).; conf_rating=**; Dbxref=PMID:15703057, PMID:16481336, locus:2035372; locus_type=protein_coding LOCN 300-UTR5 COOR C/70115-70285,70840-70968,71041-71721,71942-71998 HITS AT1G01150.2[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01150.2 CDS ID=AT1G01150.2; Parent=AT1G01150; Name=AT1G01150.2; Note=Homeodomain-like protein with RING/FYVE/PHD-type zinc finger domain-containing protein; computational_description=Homeodomain-like protein with RING/FYVE/PHD-type zinc finger domain%3B FUNCTIONS IN: DNA binding%2C zinc ion binding%3B INVOLVED IN: regulation of transcription%3B EXPRESSED IN: 8 plant structures%3B EXPRESSED DURING: 4 anthesis%2C petal differentiation and expansion stage%2C E expanded cotyledon stage%2C D bilateral stage%3B CONTAINS InterPro DOMAIN/s: Homeodomain-like (InterPro:IPR009057)%2C Zinc finger%2C PHD-type%2C conserved site (InterPro:IPR019786)%2C Zinc finger%2C FYVE/PHD-type (InterPro:IPR011011)%2C Homeodomain-related (InterPro:IPR012287)%2C MYB-like (InterPro:IPR017877)%3B BEST Arabidopsis thaliana protein match is: TRF-like 10 (TAIR:AT5G03780.1)%3B Has 94 Blast hits to 77 proteins in 18 species: Archae - 0%3B Bacteria - 0%3B Metazoa - 5%3B Fungi - 0%3B Plants - 86%3B Viruses - 0%3B Other Eukaryotes - 3 (source: NCBI BLink).; Dbxref=PMID:15703057, PMID:16481336, locus:2035372; locus_type=protein_coding LOCN 300-UTR5 COOR C/70115-70233,70896-70968,71041-71721,71942-71998 HITS AT1G01150.3[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01150.3 CDS ID=AT1G01150.3; Parent=AT1G01150; Name=AT1G01150.3; Note=Homeodomain-like protein with RING/FYVE/PHD-type zinc finger domain-containing protein; computational_description=Homeodomain-like protein with RING/FYVE/PHD-type zinc finger domain%3B FUNCTIONS IN: DNA binding%2C zinc ion binding%3B INVOLVED IN: regulation of transcription%3B EXPRESSED IN: 8 plant structures%3B EXPRESSED DURING: 4 anthesis%2C petal differentiation and expansion stage%2C E expanded cotyledon stage%2C D bilateral stage%3B CONTAINS InterPro DOMAIN/s: Homeodomain-like (InterPro:IPR009057)%2C Zinc finger%2C PHD-type%2C conserved site (InterPro:IPR019786)%2C Zinc finger%2C FYVE/PHD-type (InterPro:IPR011011)%2C Homeodomain-related (InterPro:IPR012287)%2C MYB-like (InterPro:IPR017877)%3B BEST Arabidopsis thaliana protein match is: TRF-like 10 (TAIR:AT5G03780.1)%3B Has 94 Blast hits to 77 proteins in 18 species: Archae - 0%3B Bacteria - 0%3B Metazoa - 5%3B Fungi - 0%3B Plants - 86%3B Viruses - 0%3B Other Eukaryotes - 3 (source: NCBI BLink).; Dbxref=PMID:15703057, PMID:16481336, locus:2035372; locus_type=protein_coding LOCN 300-UTR5 COOR C/70828-70968,71041-71721,71942-71998 HITS AT1G01160.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01160.1 CDS ID=AT1G01160.1; Parent=AT1G01160; Name=AT1G01160.1; Note=GRF1-interacting factor 2; curator_summary=Arabidopsis thaliana GRF1-interacting factor 2 (GIF2) mRNA; conf_class=2; symbol=GIF2; full_name=GRF1-interacting factor 2; computational_description=GRF1-interacting factor 2 (GIF2)%3B CONTAINS InterPro DOMAIN/s: SSXT (InterPro:IPR007726)%3B BEST Arabidopsis thaliana protein match is: GRF1-interacting factor 3 (TAIR:AT4G00850.1)%3B Has 425 Blast hits to 425 proteins in 91 species: Archae - 0%3B Bacteria - 4%3B Metazoa - 291%3B Fungi - 20%3B Plants - 89%3B Viruses - 0%3B Other Eukaryotes - 21 (source: NCBI BLink).; conf_rating=****; Dbxref=PMID:12974814, PMID:15326298, PMID:15703057, PMID:17182867, PMID:19648231, PMID:22589469, PMID:22669825, PMID:24355747, locus:2035232; locus_type=protein_coding LOCN 1000-Promotor COOR W/72583-72669,73087-73163,73287-73395,73488-73740,73822-73883 HITS AT1G01160.2[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01160.2 CDS ID=AT1G01160.2; Parent=AT1G01160; Name=AT1G01160.2; Note=GRF1-interacting factor 2; curator_summary=Arabidopsis thaliana GRF1-interacting factor 2 (GIF2) mRNA; conf_class=6; symbol=GIF2; full_name=GRF1-interacting factor 2; computational_description=GRF1-interacting factor 2 (GIF2)%3B CONTAINS InterPro DOMAIN/s: SSXT (InterPro:IPR007726)%3B BEST Arabidopsis thaliana protein match is: GRF1-interacting factor 3 (TAIR:AT4G00850.1)%3B Has 425 Blast hits to 425 proteins in 91 species: Archae - 0%3B Bacteria - 4%3B Metazoa - 291%3B Fungi - 20%3B Plants - 89%3B Viruses - 0%3B Other Eukaryotes - 21 (source: NCBI BLink).; conf_rating=**; Dbxref=PMID:12974814, PMID:15326298, PMID:15703057, PMID:17182867, PMID:19648231, PMID:22589469, PMID:22669825, PMID:24355747, locus:2035232; locus_type=protein_coding LOCN 1000-Promotor COOR W/72583-72669,72915-73016,73087-73163,73287-73395,73488-73740,73822-73883