CLON GABIseq_094A04.2  T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG CHRO chr1 EVAL 0 COOR C/93325-93325 NOTE KG781170 GABI 10K 1:93303 AGATGATTTGCAGTTTTTGCATTTTGGAACATCAAGTGAGGTATTGGATCATTTAAGAAATCTACAACACTGAAACACTGATCAATTGTAAATGGCTTCA HITS AT1G01220.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01220.1 CDS ID=AT1G01220.1; Parent=AT1G01220; Name=AT1G01220.1; Note=L-fucokinase/GDP-L-fucose pyrophosphorylase; curator_summary=Encodes a bifunctional enzyme that has both L-fucokinase and GDP-L-fucose pyrophosphorylase activities. It catalyzes the two steps of the L-fucose salvage pathway for the generation of activated GDP-L-fucose. This pathway seems to be of minor importance for cell wall polysaccharide biosynthesis compared to the de novo GDP-L-fucose biosynthesis pathway in Arabidopsis.; conf_class=6; symbol=FKGP; Alias=AtFKGP, Arabidopsis thaliana L-fucokinase/GDP-L-fucose pyrophosphorylase; full_name=L-fucokinase/GDP-L-fucose pyrophosphorylase; computational_description=L-fucokinase/GDP-L-fucose pyrophosphorylase (FKGP)%3B FUNCTIONS IN: fucose-1-phosphate guanylyltransferase activity%2C fucokinase activity%2C ATP binding%2C galactokinase activity%3B INVOLVED IN: GDP-L-fucose salvage%3B LOCATED IN: cytoplasm%3B EXPRESSED IN: 22 plant structures%3B EXPRESSED DURING: 13 growth stages%3B CONTAINS InterPro DOMAIN/s: Mevalonate/galactokinase (InterPro:IPR006206)%2C Ribosomal protein S5 domain 2-type fold (InterPro:IPR020568)%2C GHMP kinase (InterPro:IPR006204)%2C L-fucokinase (InterPro:IPR012887)%2C Ribosomal protein S5 domain 2-type fold%2C subgroup (InterPro:IPR014721)%2C GHMP kinase%2C C-terminal (InterPro:IPR013750)%3B Has 1878 Blast hits to 1819 proteins in 539 species: Archae - 59%3B Bacteria - 918%3B Metazoa - 155%3B Fungi - 3%3B Plants - 87%3B Viruses - 3%3B Other Eukaryotes - 653 (source: NCBI BLink).; conf_rating=**; Dbxref=PMID:15703057, PMID:17227549, PMID:18199744, locus:2035362; locus_type=protein_coding LOCN Exon COOR W/91750-92070,92270-92501,92569-92933,93045-93171,93271-94281,94357-95075,95160-95552 HITS AT1G01220.7[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01220.7 CDS ID=AT1G01220.7; Parent=AT1G01220; Name=AT1G01220.7; Note=L-fucokinase/GDP-L-fucose pyrophosphorylase; symbol=FKGP; Alias=AtFKGP, Arabidopsis thaliana L-fucokinase/GDP-L-fucose pyrophosphorylase; full_name=L-fucokinase/GDP-L-fucose pyrophosphorylase; Dbxref=PMID:15703057, PMID:17227549, PMID:18199744, locus:2035362; curator_summary=Encodes a bifunctional enzyme that has both L-fucokinase and GDP-L-fucose pyrophosphorylase activities. It catalyzes the two steps of the L-fucose salvage pathway for the generation of activated GDP-L-fucose. This pathway seems to be of minor importance for cell wall polysaccharide biosynthesis compared to the de novo GDP-L-fucose biosynthesis pathway in Arabidopsis.; computational_description=L-fucokinase/GDP-L-fucose pyrophosphorylase (FKGP)%3B FUNCTIONS IN: fucose-1-phosphate guanylyltransferase activity%2C fucokinase activity%2C ATP binding%2C galactokinase activity%3B INVOLVED IN: GDP-L-fucose salvage%3B LOCATED IN: cytoplasm%3B EXPRESSED IN: 22 plant structures%3B EXPRESSED DURING: 13 growth stages%3B CONTAINS InterPro DOMAIN/s: Mevalonate/galactokinase (InterPro:IPR006206)%2C Ribosomal protein S5 domain 2-type fold (InterPro:IPR020568)%2C GHMP kinase (InterPro:IPR006204)%2C L-fucokinase (InterPro:IPR012887)%2C Ribosomal protein S5 domain 2-type fold%2C subgroup (InterPro:IPR014721)%2C GHMP kinase%2C C-terminal (InterPro:IPR013750)%3B Has 1878 Blast hits to 1819 proteins in 539 species: Archae - 59%3B Bacteria - 918%3B Metazoa - 155%3B Fungi - 3%3B Plants - 87%3B Viruses - 3%3B Other Eukaryotes - 653 (source: NCBI BLink).; locus_type=protein_coding LOCN Exon COOR W/91750-92070,92270-92501,92569-92933,93045-93171,93271-94281,94357-95075,95160-95552 HITS AT1G01220.3[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01220.3 CDS ID=AT1G01220.3; Parent=AT1G01220; Name=AT1G01220.3; Note=L-fucokinase/GDP-L-fucose pyrophosphorylase; symbol=FKGP; Alias=AtFKGP, Arabidopsis thaliana L-fucokinase/GDP-L-fucose pyrophosphorylase; full_name=L-fucokinase/GDP-L-fucose pyrophosphorylase; curator_summary=Encodes a bifunctional enzyme that has both L-fucokinase and GDP-L-fucose pyrophosphorylase activities. It catalyzes the two steps of the L-fucose salvage pathway for the generation of activated GDP-L-fucose. This pathway seems to be of minor importance for cell wall polysaccharide biosynthesis compared to the de novo GDP-L-fucose biosynthesis pathway in Arabidopsis.; computational_description=L-fucokinase/GDP-L-fucose pyrophosphorylase (FKGP)%3B FUNCTIONS IN: fucose-1-phosphate guanylyltransferase activity%2C fucokinase activity%2C ATP binding%2C galactokinase activity%3B INVOLVED IN: GDP-L-fucose salvage%3B LOCATED IN: cytoplasm%3B EXPRESSED IN: 22 plant structures%3B EXPRESSED DURING: 13 growth stages%3B CONTAINS InterPro DOMAIN/s: Mevalonate/galactokinase (InterPro:IPR006206)%2C Ribosomal protein S5 domain 2-type fold (InterPro:IPR020568)%2C GHMP kinase (InterPro:IPR006204)%2C L-fucokinase (InterPro:IPR012887)%2C Ribosomal protein S5 domain 2-type fold%2C subgroup (InterPro:IPR014721)%2C GHMP kinase%2C C-terminal (InterPro:IPR013750)%3B Has 1878 Blast hits to 1819 proteins in 539 species: Archae - 59%3B Bacteria - 918%3B Metazoa - 155%3B Fungi - 3%3B Plants - 87%3B Viruses - 3%3B Other Eukaryotes - 653 (source: NCBI BLink).; Dbxref=PMID:15703057, PMID:17227549, PMID:18199744, locus:2035362; locus_type=protein_coding LOCN Exon COOR W/92246-92501,92569-92933,93045-93171,93271-94281,94357-95075,95160-95552 HITS AT1G01220.8[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01220.8 CDS ID=AT1G01220.8; Parent=AT1G01220; Name=AT1G01220.8; Note=L-fucokinase/GDP-L-fucose pyrophosphorylase; symbol=FKGP; Alias=AtFKGP, Arabidopsis thaliana L-fucokinase/GDP-L-fucose pyrophosphorylase; full_name=L-fucokinase/GDP-L-fucose pyrophosphorylase; curator_summary=Encodes a bifunctional enzyme that has both L-fucokinase and GDP-L-fucose pyrophosphorylase activities. It catalyzes the two steps of the L-fucose salvage pathway for the generation of activated GDP-L-fucose. This pathway seems to be of minor importance for cell wall polysaccharide biosynthesis compared to the de novo GDP-L-fucose biosynthesis pathway in Arabidopsis.; computational_description=L-fucokinase/GDP-L-fucose pyrophosphorylase (FKGP)%3B FUNCTIONS IN: fucose-1-phosphate guanylyltransferase activity%2C fucokinase activity%2C ATP binding%2C galactokinase activity%3B INVOLVED IN: GDP-L-fucose salvage%3B LOCATED IN: cytoplasm%3B EXPRESSED IN: 22 plant structures%3B EXPRESSED DURING: 13 growth stages%3B CONTAINS InterPro DOMAIN/s: Mevalonate/galactokinase (InterPro:IPR006206)%2C Ribosomal protein S5 domain 2-type fold (InterPro:IPR020568)%2C GHMP kinase (InterPro:IPR006204)%2C L-fucokinase (InterPro:IPR012887)%2C Ribosomal protein S5 domain 2-type fold%2C subgroup (InterPro:IPR014721)%2C GHMP kinase%2C C-terminal (InterPro:IPR013750)%3B Has 1878 Blast hits to 1819 proteins in 539 species: Archae - 59%3B Bacteria - 918%3B Metazoa - 155%3B Fungi - 3%3B Plants - 87%3B Viruses - 3%3B Other Eukaryotes - 653 (source: NCBI BLink).; Dbxref=PMID:15703057, PMID:17227549, PMID:18199744, locus:2035362; locus_type=protein_coding LOCN Exon COOR W/92246-92501,92569-92933,93045-93171,93271-94281,94357-95075,95160-95552 HITS AT1G01220.4[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01220.4 CDS ID=AT1G01220.4; Parent=AT1G01220; Name=AT1G01220.4; Note=L-fucokinase/GDP-L-fucose pyrophosphorylase; symbol=FKGP; Alias=AtFKGP, Arabidopsis thaliana L-fucokinase/GDP-L-fucose pyrophosphorylase; full_name=L-fucokinase/GDP-L-fucose pyrophosphorylase; curator_summary=Encodes a bifunctional enzyme that has both L-fucokinase and GDP-L-fucose pyrophosphorylase activities. It catalyzes the two steps of the L-fucose salvage pathway for the generation of activated GDP-L-fucose. This pathway seems to be of minor importance for cell wall polysaccharide biosynthesis compared to the de novo GDP-L-fucose biosynthesis pathway in Arabidopsis.; computational_description=L-fucokinase/GDP-L-fucose pyrophosphorylase (FKGP)%3B FUNCTIONS IN: fucose-1-phosphate guanylyltransferase activity%2C fucokinase activity%2C ATP binding%2C galactokinase activity%3B INVOLVED IN: GDP-L-fucose salvage%3B LOCATED IN: cytoplasm%3B EXPRESSED IN: 22 plant structures%3B EXPRESSED DURING: 13 growth stages%3B CONTAINS InterPro DOMAIN/s: Mevalonate/galactokinase (InterPro:IPR006206)%2C Ribosomal protein S5 domain 2-type fold (InterPro:IPR020568)%2C GHMP kinase (InterPro:IPR006204)%2C L-fucokinase (InterPro:IPR012887)%2C Ribosomal protein S5 domain 2-type fold%2C subgroup (InterPro:IPR014721)%2C GHMP kinase%2C C-terminal (InterPro:IPR013750)%3B Has 1878 Blast hits to 1819 proteins in 539 species: Archae - 59%3B Bacteria - 918%3B Metazoa - 155%3B Fungi - 3%3B Plants - 87%3B Viruses - 3%3B Other Eukaryotes - 653 (source: NCBI BLink).; Dbxref=PMID:15703057, PMID:17227549, PMID:18199744, locus:2035362; locus_type=protein_coding LOCN Exon COOR W/92270-92501,92569-92933,93045-93171,93271-94281,94357-95075,95160-95552 HITS AT1G01220.2[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01220.2 CDS ID=AT1G01220.2; Parent=AT1G01220; Name=AT1G01220.2; Note=L-fucokinase/GDP-L-fucose pyrophosphorylase; symbol=FKGP; Alias=AtFKGP, Arabidopsis thaliana L-fucokinase/GDP-L-fucose pyrophosphorylase; full_name=L-fucokinase/GDP-L-fucose pyrophosphorylase; curator_summary=Encodes a bifunctional enzyme that has both L-fucokinase and GDP-L-fucose pyrophosphorylase activities. It catalyzes the two steps of the L-fucose salvage pathway for the generation of activated GDP-L-fucose. This pathway seems to be of minor importance for cell wall polysaccharide biosynthesis compared to the de novo GDP-L-fucose biosynthesis pathway in Arabidopsis.; computational_description=L-fucokinase/GDP-L-fucose pyrophosphorylase (FKGP)%3B FUNCTIONS IN: fucose-1-phosphate guanylyltransferase activity%2C fucokinase activity%2C ATP binding%2C galactokinase activity%3B INVOLVED IN: GDP-L-fucose salvage%3B LOCATED IN: cytoplasm%3B EXPRESSED IN: 22 plant structures%3B EXPRESSED DURING: 13 growth stages%3B CONTAINS InterPro DOMAIN/s: Mevalonate/galactokinase (InterPro:IPR006206)%2C Ribosomal protein S5 domain 2-type fold (InterPro:IPR020568)%2C GHMP kinase (InterPro:IPR006204)%2C L-fucokinase (InterPro:IPR012887)%2C Ribosomal protein S5 domain 2-type fold%2C subgroup (InterPro:IPR014721)%2C GHMP kinase%2C C-terminal (InterPro:IPR013750)%3B Has 1878 Blast hits to 1819 proteins in 539 species: Archae - 59%3B Bacteria - 918%3B Metazoa - 155%3B Fungi - 3%3B Plants - 87%3B Viruses - 3%3B Other Eukaryotes - 653 (source: NCBI BLink).; Dbxref=PMID:15703057, PMID:17227549, PMID:18199744, locus:2035362; locus_type=protein_coding LOCN Exon COOR W/92583-92933,93045-93171,93271-94281,94357-95075,95160-95552 HITS AT1G01220.5[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01220.5 CDS ID=AT1G01220.5; Parent=AT1G01220; Name=AT1G01220.5; Note=L-fucokinase/GDP-L-fucose pyrophosphorylase; symbol=FKGP; Alias=AtFKGP, Arabidopsis thaliana L-fucokinase/GDP-L-fucose pyrophosphorylase; full_name=L-fucokinase/GDP-L-fucose pyrophosphorylase; curator_summary=Encodes a bifunctional enzyme that has both L-fucokinase and GDP-L-fucose pyrophosphorylase activities. It catalyzes the two steps of the L-fucose salvage pathway for the generation of activated GDP-L-fucose. This pathway seems to be of minor importance for cell wall polysaccharide biosynthesis compared to the de novo GDP-L-fucose biosynthesis pathway in Arabidopsis.; computational_description=L-fucokinase/GDP-L-fucose pyrophosphorylase (FKGP)%3B FUNCTIONS IN: fucose-1-phosphate guanylyltransferase activity%2C fucokinase activity%2C ATP binding%2C galactokinase activity%3B INVOLVED IN: GDP-L-fucose salvage%3B LOCATED IN: cytoplasm%3B EXPRESSED IN: 22 plant structures%3B EXPRESSED DURING: 13 growth stages%3B CONTAINS InterPro DOMAIN/s: Mevalonate/galactokinase (InterPro:IPR006206)%2C Ribosomal protein S5 domain 2-type fold (InterPro:IPR020568)%2C GHMP kinase (InterPro:IPR006204)%2C L-fucokinase (InterPro:IPR012887)%2C Ribosomal protein S5 domain 2-type fold%2C subgroup (InterPro:IPR014721)%2C GHMP kinase%2C C-terminal (InterPro:IPR013750)%3B Has 1878 Blast hits to 1819 proteins in 539 species: Archae - 59%3B Bacteria - 918%3B Metazoa - 155%3B Fungi - 3%3B Plants - 87%3B Viruses - 3%3B Other Eukaryotes - 653 (source: NCBI BLink).; Dbxref=PMID:15703057, PMID:17227549, PMID:18199744, locus:2035362; locus_type=protein_coding LOCN Exon COOR W/92583-92933,93045-93171,93271-94281,94357-95075,95160-95552 HITS AT1G01220.6[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01220.6 CDS ID=AT1G01220.6; Parent=AT1G01220; Name=AT1G01220.6; Note=L-fucokinase/GDP-L-fucose pyrophosphorylase; symbol=FKGP; Alias=AtFKGP, Arabidopsis thaliana L-fucokinase/GDP-L-fucose pyrophosphorylase; full_name=L-fucokinase/GDP-L-fucose pyrophosphorylase; curator_summary=Encodes a bifunctional enzyme that has both L-fucokinase and GDP-L-fucose pyrophosphorylase activities. It catalyzes the two steps of the L-fucose salvage pathway for the generation of activated GDP-L-fucose. This pathway seems to be of minor importance for cell wall polysaccharide biosynthesis compared to the de novo GDP-L-fucose biosynthesis pathway in Arabidopsis.; computational_description=L-fucokinase/GDP-L-fucose pyrophosphorylase (FKGP)%3B FUNCTIONS IN: fucose-1-phosphate guanylyltransferase activity%2C fucokinase activity%2C ATP binding%2C galactokinase activity%3B INVOLVED IN: GDP-L-fucose salvage%3B LOCATED IN: cytoplasm%3B EXPRESSED IN: 22 plant structures%3B EXPRESSED DURING: 13 growth stages%3B CONTAINS InterPro DOMAIN/s: Mevalonate/galactokinase (InterPro:IPR006206)%2C Ribosomal protein S5 domain 2-type fold (InterPro:IPR020568)%2C GHMP kinase (InterPro:IPR006204)%2C L-fucokinase (InterPro:IPR012887)%2C Ribosomal protein S5 domain 2-type fold%2C subgroup (InterPro:IPR014721)%2C GHMP kinase%2C C-terminal (InterPro:IPR013750)%3B Has 1878 Blast hits to 1819 proteins in 539 species: Archae - 59%3B Bacteria - 918%3B Metazoa - 155%3B Fungi - 3%3B Plants - 87%3B Viruses - 3%3B Other Eukaryotes - 653 (source: NCBI BLink).; Dbxref=PMID:15703057, PMID:17227549, PMID:18199744, locus:2035362; locus_type=protein_coding LOCN Exon COOR W/92583-92933,93045-93171,93271-94281,94357-95075,95160-95552