CLON GABIseq_075A03.2  T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG CHRO chr2 EVAL 0 COOR C/17016531-17016531 NOTE KG780963 GABI 10K 2:17016531 TGATCAATTTCTAGAATCCTATCTATCACTTTCTTTCTAGATCTCTCCAGCATATCCATACACGTCTGCAGATGAAGTTTCATGCCATGTATAGTTCTAA HITS AT2G40770.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT2G40770.1 CDS ID=AT2G40770.1; Parent=AT2G40770; Name=AT2G40770.1; Note=RING-finger%2C DEAD-like helicase%2C PHD and SNF2 domain-containing protein; conf_class=4; computational_description=zinc ion binding%3BDNA binding%3Bhelicases%3BATP binding%3Bnucleic acid binding%3B FUNCTIONS IN: helicase activity%2C DNA binding%2C zinc ion binding%2C nucleic acid binding%2C ATP binding%3B EXPRESSED IN: 21 plant structures%3B EXPRESSED DURING: 11 growth stages%3B CONTAINS InterPro DOMAIN/s: Zinc finger%2C RING-type (InterPro:IPR001841)%2C Zinc finger%2C PHD-type%2C conserved site (InterPro:IPR019786)%2C Zinc finger%2C PHD-type (InterPro:IPR001965)%2C SNF2-related (InterPro:IPR000330)%2C DEAD-like helicase%2C N-terminal (InterPro:IPR014001)%2C Zinc finger%2C FYVE/PHD-type (InterPro:IPR011011)%2C DNA/RNA helicase%2C C-terminal (InterPro:IPR001650)%2C Tetratricopeptide repeat-containing (InterPro:IPR013026)%3B BEST Arabidopsis thaliana protein match is: SNF2 domain-containing protein / helicase domain-containing protein / zinc finger protein-related (TAIR:AT1G61140.1)%3B Has 20880 Blast hits to 12947 proteins in 1504 species: Archae - 88%3B Bacteria - 5732%3B Metazoa - 4955%3B Fungi - 5171%3B Plants - 2134%3B Viruses - 115%3B Other Eukaryotes - 2685 (source: NCBI BLink).; conf_rating=***; Dbxref=PMID:11983057, PMID:16132859, PMID:16489130, PMID:18310306, locus:2064786; locus_type=protein_coding LOCN Exon COOR C/17013535-17013825,17013928-17014183,17014277-17014428,17014500-17014693,17014833-17015034,17015339-17015581,17015687-17015803,17016020-17016226,17016317-17016533,17016864-17017030,17017222-17017761,17017828-17017988,17018127-17018358,17018433-17018688,17018954-17019154,17019297-17019771,17019988-17020049,17020210-17020416,17020501-17021315 HITS AT2G40770.2[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT2G40770.2 CDS ID=AT2G40770.2; Parent=AT2G40770; Name=AT2G40770.2; Note=RING-finger%2C DEAD-like helicase%2C PHD and SNF2 domain-containing protein; Dbxref=PMID:11983057, PMID:16132859, PMID:16489130, PMID:18310306, locus:2064786; computational_description=zinc ion binding%3BDNA binding%3Bhelicases%3BATP binding%3Bnucleic acid binding%3B FUNCTIONS IN: helicase activity%2C DNA binding%2C zinc ion binding%2C nucleic acid binding%2C ATP binding%3B EXPRESSED IN: 21 plant structures%3B EXPRESSED DURING: 11 growth stages%3B CONTAINS InterPro DOMAIN/s: Zinc finger%2C RING-type (InterPro:IPR001841)%2C Zinc finger%2C PHD-type%2C conserved site (InterPro:IPR019786)%2C Zinc finger%2C PHD-type (InterPro:IPR001965)%2C SNF2-related (InterPro:IPR000330)%2C DEAD-like helicase%2C N-terminal (InterPro:IPR014001)%2C Zinc finger%2C FYVE/PHD-type (InterPro:IPR011011)%2C DNA/RNA helicase%2C C-terminal (InterPro:IPR001650)%2C Tetratricopeptide repeat-containing (InterPro:IPR013026)%3B BEST Arabidopsis thaliana protein match is: SNF2 domain-containing protein / helicase domain-containing protein / zinc finger protein-related (TAIR:AT1G61140.1)%3B Has 20880 Blast hits to 12947 proteins in 1504 species: Archae - 88%3B Bacteria - 5732%3B Metazoa - 4955%3B Fungi - 5171%3B Plants - 2134%3B Viruses - 115%3B Other Eukaryotes - 2685 (source: NCBI BLink).; locus_type=protein_coding LOCN Exon COOR C/17013535-17013825,17013928-17014183,17014277-17014428,17014500-17014693,17014833-17015034,17015339-17015581,17015687-17015803,17016020-17016226,17016317-17016533,17016864-17017030,17017222-17017761,17017828-17017988,17018127-17018358,17018433-17018688,17018954-17019154,17019297-17019771,17019988-17020049,17020210-17020416,17020501-17021315 HITS AT2G40770.3[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT2G40770.3 CDS ID=AT2G40770.3; Parent=AT2G40770; Name=AT2G40770.3; Note=RING-finger%2C DEAD-like helicase%2C PHD and SNF2 domain-containing protein; Dbxref=PMID:11983057, PMID:16132859, PMID:16489130, PMID:18310306, locus:2064786; computational_description=zinc ion binding%3BDNA binding%3Bhelicases%3BATP binding%3Bnucleic acid binding%3B FUNCTIONS IN: helicase activity%2C DNA binding%2C zinc ion binding%2C nucleic acid binding%2C ATP binding%3B EXPRESSED IN: 21 plant structures%3B EXPRESSED DURING: 11 growth stages%3B CONTAINS InterPro DOMAIN/s: Zinc finger%2C RING-type (InterPro:IPR001841)%2C Zinc finger%2C PHD-type%2C conserved site (InterPro:IPR019786)%2C Zinc finger%2C PHD-type (InterPro:IPR001965)%2C SNF2-related (InterPro:IPR000330)%2C DEAD-like helicase%2C N-terminal (InterPro:IPR014001)%2C Zinc finger%2C FYVE/PHD-type (InterPro:IPR011011)%2C DNA/RNA helicase%2C C-terminal (InterPro:IPR001650)%2C Tetratricopeptide repeat-containing (InterPro:IPR013026)%3B BEST Arabidopsis thaliana protein match is: SNF2 domain-containing protein / helicase domain-containing protein / zinc finger protein-related (TAIR:AT1G61140.1)%3B Has 20880 Blast hits to 12947 proteins in 1504 species: Archae - 88%3B Bacteria - 5732%3B Metazoa - 4955%3B Fungi - 5171%3B Plants - 2134%3B Viruses - 115%3B Other Eukaryotes - 2685 (source: NCBI BLink).; locus_type=protein_coding LOCN Exon COOR C/17013535-17013825,17013928-17014183,17014277-17014428,17014500-17014693,17014833-17015034,17015339-17015581,17015687-17015803,17016020-17016226,17016317-17016533,17016864-17017030,17017222-17017761,17017828-17017988,17018127-17018358,17018433-17018688,17018954-17019154,17019297-17019771,17019988-17020049,17020210-17020416,17020501-17021315