CLON GABI_241G09[Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] 
TYPE GABI-Kat FST
CHRO chr1
EVAL 8e-18
COOR W/24883252-24883307

HITS At1g66725[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MIPS] [MPSS] [AMPDB/SUBA] [KEGG] 
[Protein Interaction] [TIGR] [Synteny Gene Pairs] [AtGene Express] [AtGDB View] [e-FP Browser] [NASCArrays Digital Northern]
[YE Clone] [NASCArrays Spot History] [Genevestigator Gene Atlas Gene Chronologer Response Viewer] [POGs] [AthaMap]
[Methylome] [UToronto BAR Expression Angler NASCArrays BADB Hormone Stress Pathogen Tissue Ext Tissue] TYPE Gene TITL AT1G66725.1 miRNA gene_syn MICRORNA 163, MIR163 gene MIR163 function Encodes a microRNA that targets several SAMT family members. miR163, is highly expressed in A. thaliana diploids but down-regulated in A. thaliana autotetraploids and repressed in A. arenosa and A. suecica. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UUGAAGAGGACUUGGAACUUCGAU go_component cellular_component|GO:0005575||ND go_process gene silencing by miRNA|GO:0035195|15314213|TAS go_function molecular_function|GO:0003674||ND product MIR163 (MICRORNA 163); miRNA transcript_id AT1G66725.1 LOCN 1000-Promotor COOR W/24883931-24884559 CLON GABI_241G09[Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] TYPE GABI-Kat FST CHRO chr2 EVAL 1e-16 COOR C/15725321-15725383 HITS At2g37450[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MIPS] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [Synteny Gene Pairs] [AtGene Express] [AtGDB View] [e-FP Browser] [NASCArrays Digital Northern]
[YE Clone] [NASCArrays Spot History] [Genevestigator Gene Atlas Gene Chronologer Response Viewer] [POGs] [AthaMap]
[Methylome] [UToronto BAR Expression Angler NASCArrays BADB Hormone Stress Pathogen Tissue Ext Tissue] TYPE Gene TITL AT2G37450.1 CDS gene_syn F3G5.24, F3G5_24 go_component endomembrane system|GO:0012505||IEA go_component membrane|GO:0016020||IEA product nodulin MtN21 family protein note nodulin MtN21 family protein; LOCATED IN: endomembrane system, membrane; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF6, transmembrane (InterPro:IPR000620); BEST Arabidopsis thaliana protein match is: nodulin MtN21 family protein (TAIR:AT2G37460.1); Has 943 Blast hits to 839 proteins in 125 species: Archae - 10; Bacteria - 183; Metazoa - 0; Fungi - 0; Plants - 707; Viruses - 0; Other Eukaryotes - 43 (source: NCBI BLink). protein_id AT2G37450.1p transcript_id AT2G37450.1 protein_id AT2G37450.1p transcript_id AT2G37450.1 LOCN 1000-Promotor COOR C/15722828-15722990,15723081-15723232,15723330-15723491,15723570-15723804,15724670-15724851 HITS At2g37450[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MIPS] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [Synteny Gene Pairs] [AtGene Express] [AtGDB View] [e-FP Browser] [NASCArrays Digital Northern]
[YE Clone] [NASCArrays Spot History] [Genevestigator Gene Atlas Gene Chronologer Response Viewer] [POGs] [AthaMap]
[Methylome] [UToronto BAR Expression Angler NASCArrays BADB Hormone Stress Pathogen Tissue Ext Tissue] TYPE Gene TITL AT2G37450.2 CDS gene_syn F3G5.24, F3G5_24 go_component endomembrane system|GO:0012505||IEA go_component membrane|GO:0016020||IEA product nodulin MtN21 family protein note nodulin MtN21 family protein; LOCATED IN: endomembrane system, membrane; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF6, transmembrane (InterPro:IPR000620); BEST Arabidopsis thaliana protein match is: nodulin MtN21 family protein (TAIR:AT2G37460.1); Has 1114 Blast hits to 1107 proteins in 199 species: Archae - 19; Bacteria - 329; Metazoa - 4; Fungi - 0; Plants - 633; Viruses - 0; Other Eukaryotes - 129 (source: NCBI BLink). protein_id AT2G37450.2p transcript_id AT2G37450.2 protein_id AT2G37450.2p transcript_id AT2G37450.2 LOCN 1000-Promotor COOR C/15722828-15722990,15723081-15723232,15723330-15723491,15723570-15723921,15724670-15724851