CLON GABI_089F03[Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] 
TYPE GABI-Kat FST
CHRO chr1
EVAL e-145
COOR W/78969-79232
NOTE - -

HITS AT1G08765.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG] 
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G08765.1 transcript_region ID=AT1G08765.1; Parent=AT1G08765; computational_description=novel transcribed region; Name=AT1G08765.1; locus_type=novel_transcribed_region LOCN Exon COOR W/77537-80345 HITS AT1G08765.2[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G08765.2 transcript_region ID=AT1G08765.2; Parent=AT1G08765; computational_description=novel transcribed region; Name=AT1G08765.2; locus_type=novel_transcribed_region LOCN Exon COOR W/77727-79340 HITS AT1TE00225[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1TE00225 transposable_element ID=AT1TE00225; Name=AT1TE00225; Alias=HELITRONY1D LOCN 300-UTR5 COOR C/78288-78785 HITS AT1G01183.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01183.1 miRNA_primary_transcript ID=AT1G01183.1; Parent=AT1G01183; Alias=p_MI0000199; Name=ath-MIR165a; symbol=MIR165A; curator_summary=Encodes a microRNA that targets several HD-ZIPIII family members including PHV%2C PHB%2C REV%2C ATHB-8%2C and ATHB-15. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCGGACCAGGCUUCAUCCCC; Note=microRNA ath-MIR165a precursor; full_name=microRNA165A; Dbxref=PMID:15200956, PMID:18794352, PMID:19054365, PMID:17549070, PMID:19704656, PMID:19879265, PMID:20410882, PMID:21483759, PMID:21558378, PMID:21610018, PMID:22476466, PMID:22589131, PMID:22951404, PMID:23292599, PMID:23645346, PMID:23918970, PMID:23935517, PMID:24296072, locus:1009023078, PMID:15200956, PMID:18794352, PMID:19054365, PMID:17549070, PMID:19704656, PMID:19879265, PMID:20410882, PMID:21483759, PMID:21558378, PMID:21610018, PMID:22476466, PMID:22589131, PMID:22951404, PMID:23292599, PMID:23645346, PMID:23918970, PMID:23935517, PMID:24296072, PMID:25406978, PMID:25711809, locus:1009023078; locus_type=mirna LOCN Exon COOR C/78927-79037 HITS ath-miR165a-3p[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL ath-miR165a-3p miRNA ID=ath-miR165a-3p; Alias=MIMAT0000187; Name=ath-miR165a-3p; Derives_from=AT1G01183.1; Note=microRNA ath-miR165a-3p; computational_description=mature miRNA accession:MIMAT0000187 LOCN 300-UTR5 COOR C/78932-78952 HITS ath-miR165a-5p[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL ath-miR165a-5p miRNA ID=ath-miR165a-5p; Alias=MIMAT0031879; Name=ath-miR165a-5p; Derives_from=AT1G01183.1; Note=microRNA ath-miR165a-5p; computational_description=mature miRNA accession:MIMAT0031879 LOCN 300-UTR3 COOR C/79010-79030 CLON GABI_089F03[Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST CHRO chr5 EVAL 0.0 COOR W/2345972-2346459 NOTE - - HITS AT5G07410.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT5G07410.1 CDS ID=AT5G07410.1; Parent=AT5G07410; Name=AT5G07410.1; Note=Pectin lyase-like superfamily protein; curator_summary=Encodes a pectin methylesterase implicated in the remodeling of pectins in pollen. Its expression is restricted to the male gametophyte (dry pollen%2C imbibed pollen and pollen tube). Mutants do not display any phenotype in the vegetative tissues. Pollen germination of KO mutant is strongly delayed in vivo and in vitro. Extra calcium restores the wild type phenotype in vitro.; conf_class=2; Alias=AtPME48, PME48, pectin methylesterase 48; computational_description=Pectin lyase-like superfamily protein%3B FUNCTIONS IN: pectinesterase activity%3B INVOLVED IN: cell wall modification%3B LOCATED IN: endomembrane system%2C cell wall%2C plant-type cell wall%3B EXPRESSED IN: male gametophyte%2C flower%2C pollen tube%3B EXPRESSED DURING: L mature pollen stage%2C M germinated pollen stage%3B CONTAINS InterPro DOMAIN/s: Pectin lyase fold/virulence factor (InterPro:IPR011050)%2C Pectinesterase%2C catalytic (InterPro:IPR000070)%2C Pectin lyase fold (InterPro:IPR012334)%3B BEST Arabidopsis thaliana protein match is: Pectin lyase-like superfamily protein (TAIR:AT1G69940.1)%3B Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12%3B Bacteria - 1396%3B Metazoa - 17338%3B Fungi - 3422%3B Plants - 5037%3B Viruses - 0%3B Other Eukaryotes - 2996 (source: NCBI BLink).; conf_rating=****; Dbxref=PMID:16622707, PMID:18502975, PMID:18775970, PMID:21798377, PMID:25524442, locus:2183334; locus_type=protein_coding LOCN Exon COOR W/2345852-2346055,2346145-2346420,2346508-2346714,2346788-2347026,2347117-2347276